Dataset for CDS BAX of Organism Bos mutus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|L8IM55_BAX-02 BCL2-associated X gene OS=[Eukaryota] Bos mutus GN=BAX (length=579 residues).
atggacgggtccggggagcaacccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaggatcgagcagggcgaatggggggagagacacccgagctgggcttggagcaggtgccccaggatg
catccaccaagaagctgagcgagtgtctgaagcgcatcggagatgaattggacagtaacatggagctgcagaggatgatc
gcagctgtggacacagactctccccgagaggtctttttccgagtggcggctgaaatgttttccgacggcaacttcaactg
gggccgggttgtcgcccttttctactttgccagcaaactggtgctcaaggccctgtgcaccaaggtgcccgagttgatca
ggaccatcatgggctggacattggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgggacggc
ctcctctcctactttgggacacccacatggcagacagtgaccatctttgtggctggagtgctcaccgcctcgctcaccat
ctggaagaagatgggctga
>gnl|bcl2dbcds|L8IM55_BAX-01 BCL2-associated X gene OS=[Eukaryota] Bos mutus GN=BAX (length=1278 residues).
atgagaccccattctgattctgtatccccgcaactccgttcccaccctagtttcatccaggatcgagcagggcgaatggg
gggagagacacccgagctgggcttggagcaggtgccccaggatgcatccaccaagaagctgagcgagtgtctgaagcgca
tcggagatgaattggacagtaacatggagctgcagaggatgatcgcagctgtggacacagactctccccgagaggtcttt
ttccgagtggcggctgaaatgttttccgacggcaacttcaactggggccgggttgtcgcccttttctactttgccagcaa
actggtgctcaaggccctgtgcaccaaggtgcccgagttgatcaggaccatcatgggctggacattggacttccttcgag
agcggctgctgggctggatccaggaccagggtggttgggtgagacctctaaccccaccccattcccccactcctctgggg
cccttgggcctttctgtgcccaccataggagtgcccccttccccattttggggtcatatgtctgatcaacccctgattca
cagggtgcccaatgacctgtccatgacccttgacctcctcatgacctctgacctcctagtgacccctgacccgatgcctc
gctgccctccctggtgcctccctccaattcctctggaatccctcaagttctatgataatcctttaacttccccactcgta
ggcccttgcccctacttgtgccctctgacccctccctgctccctcatgtgctggcccaggggctgccccttggctgagtc
gatgaagtgcctgctgtccctgtccccaggacggcctcctctcctactttgggacacccacatggcagacagtgaccatc
tttgtggctggagtgctcaccgcctcgctcaccatctggaagaagatgggctgaggccatcaactgccttggactttttc
tgcataaattatggcatttttcaggggggtggggcggatttgggggccatgggagtttttcttacttttttaattattgg
ggtggggcagggtagggaggcgtggtcttggggggtgggcacaataaacctctttcggaccacactttggagtctgagtc
actgggcccgcttcctggctgtcgcaggagaccaggcttcatgcgctgacccatctttttctgagggtaaccagtgccct
ctgtgggtcagtggcgagttaaattgtggctctgccctcaaggagcccacagtcctgaggggaactgaggcggcttga
© 1998-2020Legal notice