Dataset for CDS BCL-2 of organism Aquila chrysaetos chrysaetos

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A663FHR0_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Aquila chrysaetos chrysaetos GN=BCL-2 (length=738 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagagggg
atacgactgggctgccgccgaggacagggcacccctgcctccgggtctctctcctcctcctgctgctgctgctgcggttg
ctgctgctgctgctgctgctgctgggacttcctctgatcacactgggctggtgtctccgcaccccgagccccccggctcg
gctgctgctagccacgcgcccccggccgaggggctgccccccgcgccccaggtcgtccacctcgccctgcgccaggcggg
cgacgagttctcccgccgctaccagagggacttcgcccaaatgtccggccagctgcacctgacgcccttcacggccaggg
gccgcttcgtggcggtggtggaggagctcttccgagacggcgttaactggggcaggatcgtggccttcttcgagttcggc
ggcgtgatgtgcgtggagagcgtcaaccgggagatgtctcccctcgtagacagcatcgccgcctggatgaccgagtacct
gaaccggcacctgcacaactggatccaggacaacggaggctgggatgccttcgtggagttgtatggcaacagtatgaggc
ctttgttcgatttctcctggatctctctgaagactatcctgagtctggttctggtgggagcttgcatcactcttggcgct
tatcttggacataagtag
© 1998-2020Legal notice