Dataset for CDS BCL-2 of organism Heterocephalus glaber

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

G5BGZ7_BCL2-01      atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccac
G5BGZ7_BCL2-02      atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccac

G5BGZ7_BCL2-01      tataagctgtcccagaggggctacgagtgggatgccggagacggcagcgccgcgccccct
G5BGZ7_BCL2-02      tataagctgtcccagaggggctacgagtgggatgccggagacggcagcgccgcgccccct

G5BGZ7_BCL2-01      ggggccgcccccacgcctggcatcttctcctcccagccgggtcgaaattccccgcccgct
G5BGZ7_BCL2-02      ggggccgcccccacgcctggcatcttctcctcccagccgggtcgaaattccccgcccgct

G5BGZ7_BCL2-01      gcgccccgggacctggccgccaggacctcgccgccgccgcccctggccggcctcgccgct
G5BGZ7_BCL2-02      gcgccccgggacctggccgccaggacctcgccgccgccgcccctggccggcctcgccgct

G5BGZ7_BCL2-01      gccgcggggcctgtgctcagtccggtgccacctgtggtccacctgaccctccgccaggcc
G5BGZ7_BCL2-02      gccgcggggcctgtgctcagtccggtgccacctgtggtccacctgaccctccgccaggcc

G5BGZ7_BCL2-01      ggcgatgacttctcccgtcgctaccgccgcgacttcgccgagatgtccagccagctgcac
G5BGZ7_BCL2-02      ggcgatgacttctcccgtcgctaccgccgcgacttcgccgagatgtccagccagctgcac

G5BGZ7_BCL2-01      ctgacgcctttcaccgcgaggggacgctttgccacggtggtggaggagctcttcagggat
G5BGZ7_BCL2-02      ctgacgcctttcaccgcgaggggacgctttgccacggtggtggaggagctcttcagggat

G5BGZ7_BCL2-01      ggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
G5BGZ7_BCL2-02      ggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag

G5BGZ7_BCL2-01      agcgtcaaccgggagatgtcgcccctggtggacaacattgccctctggatgactgagtac
G5BGZ7_BCL2-02      agcgtcaaccgggagatgtcgcccctggtggacaacattgccctctggatgactgagtac

G5BGZ7_BCL2-01      ctgaaccggcacctgcacacctggatccaggataacggaggctgggacgcctttgtggag
G5BGZ7_BCL2-02      ctgaaccggcacctgcacacctggatccaggataacggaggctgg---------gtagga
                    *********************************************         ** *  

G5BGZ7_BCL2-01      ctgtatggccccagtgttcggcctctgtttgacttctcctggctgtctttgaagactctg
G5BGZ7_BCL2-02      cta------------------------------------agacagcccacagatactatg
                    **                                      * * * *     * *** **

G5BGZ7_BCL2-01      ctcagcctggccctggtgggagcctgcatcaccctgggtgcctacctgggacacaagtga
G5BGZ7_BCL2-02      gcaagtctcatgtgtgttggcctctgggttaaattgggggc---------------atga
                       ** **       ** **   ***  * *   **** **                ***

© 1998-2021Legal notice