Dataset for CDS BAX-like of Organism Accipiter nisus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B9N5L5_BOK-01       atgg-----aggtgctacgccgttcctcagtct-----------------
A0A8B9NH28_BAX-01       at-------gcggacgggggcgatc-------------------------
A0A8B9NHL2_BAK1-01      atggcctcagggaacgacggtgacccaccgagggcccacagacgccgggg
A0A8B9NHL2_BAK1-02      atggcctcagggaacgacggtgacccaccgagggcccacagacgccgggg
                        **         *  *   *  *  *                         

A0A8B9N5L5_BOK-01       ----------------ttgctgcagaggt----------------gatgg
A0A8B9NH28_BAX-01       ----------------ctgctgcgggggtttatcc---gggaccgcgtgg
A0A8B9NHL2_BAK1-01      aagcaacaggcgcaggctgtcacaagagctcaactcagaagaccaagtgg
A0A8B9NHL2_BAK1-02      aagcaacaggcgcaggctgtcacaagagctcaactcagaagaccaagtgg
                                         **   *    *                   ***

A0A8B9N5L5_BOK-01       aggtttttgataggtctcccactgacaaggagcttgtgtcccaagccaag
A0A8B9NH28_BAX-01       agcggtgcgg------------ggacgcgcaggcagtggccctgagccag
A0A8B9NHL2_BAK1-01      tg------ga------------ggagacggaggaggtgtttcggagctat
A0A8B9NHL2_BAK1-02      tg------ga------------ggagacggaggaggtgtttcggagctat
                         *      *              **   * **   ***   *    * * 

A0A8B9N5L5_BOK-01       gctctctgcagagactacataaattcaaggctaattcgagcgggcgtcag
A0A8B9NH28_BAX-01       gct--------------------------------gagctgggggggccg
A0A8B9NHL2_BAK1-01      gccttctac-----cgctatcaacaggagagagaggagagaggggaggag
A0A8B9NHL2_BAK1-02      gccttctac-----cgctatcaacaggagagagaggagagaggggaggag
                        **                                   *   ***     *

A0A8B9N5L5_BOK-01       ctg--gagcaaacctgag----------------------tgcaatgcac
A0A8B9NH28_BAX-01       cagcccagcagccctgacac-----------------------gaagcac
A0A8B9NHL2_BAK1-01      gtgcccatggacccagagattgtggagatccagcaggagctgggcagcac
A0A8B9NHL2_BAK1-02      gtgcccatggacccagagattgtggagatccagcaggagctgggcagcac
                          *   *     ** **                             ****

A0A8B9N5L5_BOK-01       c-agtgcctggtggtaagctggccgaggtgtccaccatactgctgcgact
A0A8B9NH28_BAX-01       c----------tgagcgagtgct-----tgcgccgca------------t
A0A8B9NHL2_BAK1-01      cgggagcctggtaggaaggcgcc-----tggccatca------------t
A0A8B9NHL2_BAK1-02      cgggagcctggtaggaaggcgcc-----tggccatca------------t
                        *          *        *       **  *  **            *

A0A8B9N5L5_BOK-01       aggggatgagctggaatacattcgccccaacgtctaccggaatatcgccc
A0A8B9NH28_BAX-01       cggggacgagctgg---aca------gcaaca-----cggagctgcagag
A0A8B9NHL2_BAK1-01      cggtgacgacatta---ataagcggtacgatg-----cggagtttcgcta
A0A8B9NHL2_BAK1-02      cggtgacgacatta---ataagcggtacgatg-----cggagtttcgcta
                         ** ** **  *     * *       * *       ****    *    

A0A8B9N5L5_BOK-01       gccaattgaacatctca-----ctgcactcggagacggtggtgacggacg
A0A8B9NH28_BAX-01       gatgattgaacaggtggggtgccatgcccccaag------------gagc
A0A8B9NHL2_BAK1-01      catgctgaaatccttg------cagcccaccaaggagaacgtctacgagc
A0A8B9NHL2_BAK1-02      catgctgaaatccttg------cagcccaccaaggagaacgtctacgagc
                             *  **    *       *    * *  **            **  

A0A8B9N5L5_BOK-01       ccttcctggcagtagctgcgcagattttc----------------actgc
A0A8B9NH28_BAX-01       tcttcttccgcgtggctgcagagatgtttgccgacggcaccttcaactgg
A0A8B9NHL2_BAK1-01      acttcaccagaatagcctccagcttgttcgagagcggca---ttaactgg
A0A8B9NHL2_BAK1-02      acttcaccagaatagcctccagcttgttcgagagcggca---ttaactgg
                         ****       * **  *     * **                 **** 

A0A8B9N5L5_BOK-01       agctgggctggcagtggactgtgtgcggcatgc---acagccagcca--t
A0A8B9NH28_BAX-01       ggccgtgttgttgccctcttctacttcgcctgcaagctggtgctgaaggc
A0A8B9NHL2_BAK1-01      ggccgggtgattgcgctgctgggtttcggctaccgcatggccatcca--c
A0A8B9NHL2_BAK1-02      ggccgggtgattgcgctgctgggtttcggctaccgcatggccatcca--c
                         ** * *            *       *  * *      *      *   

A0A8B9N5L5_BOK-01       ggttcacaccattgt-----agattgcctgggagagtttgtcc---gcaa
A0A8B9NH28_BAX-01       gctttgcaccaaggtccctgag-----ctggtccggaccatcctgggctg
A0A8B9NHL2_BAK1-01      gtctaccagcacggcacaaggggtttcctctactggatcaccc---gctt
A0A8B9NHL2_BAK1-02      gtctaccagcacggcacaaggggtttcctctactggatcaccc---gctt
                        *  *  ** **  *       *     **      *     **   **  

A0A8B9N5L5_BOK-01       gaccctggtg-acatg------------------------------gctg
A0A8B9NH28_BAX-01       gaccatggagtacatg---cgggatcatgtcctagcctggatccaggcc-
A0A8B9NHL2_BAK1-01      cgtctcggagttcatgctccgcaaccgcatcgcccagtggatc---gccc
A0A8B9NHL2_BAK1-02      cgtctcggagttcatgctccgcaaccgcatcgcccagtggatc---gccc
                           *  ** *  ****                              **  

A0A8B9N5L5_BOK-01       aaaaggagaggaggctgggcagacatcacaaaatgtgtggtgaatactga
A0A8B9NH28_BAX-01       --cag----ggaggatgggaagg---------------------------
A0A8B9NHL2_BAK1-01      agcag----ggaggatgggtg-----------------------------
A0A8B9NHL2_BAK1-02      agcag----ggaggatgggtgagccagcgggaacgtggggctgtcccagg
                           **    ***** ****                               

A0A8B9N5L5_BOK-01       ccccag-------------------ccttcgctctcactggctcgtg---
A0A8B9NH28_BAX-01       -------------------------gcttctctcctactttggcactccg
A0A8B9NHL2_BAK1-01      -------------------------gctgcactcgagctggacaatgttt
A0A8B9NHL2_BAK1-02      gggaatttggggacaaggggaggcagccgtgctccggccggtgaacg---
                                                  *    ***   *            

A0A8B9N5L5_BOK-01       ---------gcagc----tgtttgcagctttggtcacttcctcaaggcta
A0A8B9NH28_BAX-01       acctg----gcagaccatcaccatcttcgccgctggtgtcctcacggcct
A0A8B9NHL2_BAK1-01      acatgaagtacatgctggtggtggtggccct-----ggtcatggtggggc
A0A8B9NHL2_BAK1-02      -------gcgcagcctggggactacggcactgctgcggtc--ggtggggt
                                  **               *          **     **   

A0A8B9N5L5_BOK-01       tcttcttcgtcctg------------ctgcccgagag----atga
A0A8B9NH28_BAX-01       cgctcaccatctgg-------------------aagatgtcatag
A0A8B9NHL2_BAK1-01      --------atttagtggtacgacg--cttcttcaggc---cctaa
A0A8B9NHL2_BAK1-02      tacccgggtgccagcagagcagcaacctggcccaggcagatctaa
                                     *                   *        *  

© 1998-2023Legal notice