Dataset for CDS BCL-2-like of organism Catharus ustulatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C3U920_BCL2A1-      atggaa-----------------------------------actgctgag
A0A8C3U3Q2_BCL2L1-      at-gtaca-----------------gcagtaatcgggcgttagtgattga
A0A8C3TNF2_BCL2-01      atggctcatccggggagaagaggctacgataaccgggagatagtgctgaa
A0A8C3UEV5_MCL1-01      at-gctc----------------------------------ggtgctgca
                        ** *                                       ** *   

A0A8C3U920_BCL2A1-      -------------------ttctattacgtttattactta-----gct--
A0A8C3U3Q2_BCL2L1-      ctttgtttcctacaagctctcccagaaaggatacagctggagtcagctgg
A0A8C3TNF2_BCL2-01      gtacatccactataaactctcccagaggggatacgactgg-----gctgc
A0A8C3UEV5_MCL1-01      gaa-----------------ccgagagcgaagctggctga-----gccg-
                                             * *    *       **       **   

A0A8C3U920_BCL2A1-      ----------------cagga-----ttatctgcagt-------------
A0A8C3U3Q2_BCL2L1-      aggaggaggatgagaacaggactgactt---tgcagg------------g
A0A8C3TNF2_BCL2-01      cgg-------tgaggacagggcacccctgcctccaggtctctctgctcct
A0A8C3UEV5_MCL1-01      -----------ggggaggggacacacgtggccgcagg-------------
                                          **       *     ***              

A0A8C3U920_BCL2A1-      -------atgtg--------------ctccaggaatcccacctggga---
A0A8C3U3Q2_BCL2L1-      gaggaggacgagatggacggcgtcctcaacgggagcccctcctggcacgc
A0A8C3TNF2_BCL2-01      gctgctgctgcggtt---gctgctgctgctgggacttcctctgatcacac
A0A8C3UEV5_MCL1-01      gatggggatggggatggggacgctttttccgggactcct-----------
                                 * *                   ***   *            

A0A8C3U920_BCL2A1-      -------------------ccagcccagaccagggttgctcatg-tcctg
A0A8C3U3Q2_BCL2L1-      a------------------cccaccagccacatagtgaacggagcctccg
A0A8C3TNF2_BCL2-01      tgggctggtgtctccgcaccccgagccccccggctcggc------tgctg
A0A8C3UEV5_MCL1-01      --gggtggt----------cccgaccggcccggcgcggcgggggatgctg
                                           **         *                * *

A0A8C3U920_BCL2A1-      cgaaccatggcatctt----------------------ccttgca-----
A0A8C3U3Q2_BCL2L1-      tgcaccagagcagcctcgaagcccatgagatc----cgtcgagcacccga
A0A8C3TNF2_BCL2-01      ctagccacgcgcccct---ggccgaggggctg----cgccccgcacccca
A0A8C3UEV5_MCL1-01      tga------------t---ggagaaggcgctggagacgctgcgga----g
                                       *                          * *     

A0A8C3U920_BCL2A1-      ------------------agaccaaaccgagga--ggctctcaggccact
A0A8C3U3Q2_BCL2L1-      cgacgtgaggcaggcgctgagagaggcgggggatgagtttgagctgaggt
A0A8C3TNF2_BCL2-01      ggtcgtccaccttgtcctgcgccaggcgggggatgagttctcccgacgct
A0A8C3UEV5_MCL1-01      ggtcggtgatggagtgatgca------gaaacacgagct-------cgct
                                                        *   * *          *

A0A8C3U920_BCL2A1-      cctggacaggattgac---atcacctctgtagctg---------------
A0A8C3U3Q2_BCL2L1-      accggcgggcgttcagcgacctcacttcccagctccacatcactcccagc
A0A8C3TNF2_BCL2-01      accagagggactttgcccaaatgtctggccagctgcacctgacgcccttc
A0A8C3UEV5_MCL1-01      tttcaagggatgctgc-----------ggaagctg-----gaaatccagc
                                *                     ****                

A0A8C3U920_BCL2A1-      -ttgccaagagaattttcaatggagtcatggatgaa---------aagtt
A0A8C3U3Q2_BCL2L1-      acagcatatcagagctttgagcaggtagtgaacgaa---------ctgtt
A0A8C3TNF2_BCL2-01      acggccaggagccgcttcgtggccgtggtggaggag---------ctctt
A0A8C3UEV5_MCL1-01      aggaggaggacctgc----agtcggtggtggaggtggctgcacacctgtt
                                                **  ** * *              **

A0A8C3U920_BCL2A1-      tgctgatggaaatactaactggggaagaattatgaccatatttacatttg
A0A8C3U3Q2_BCL2L1-      ccgagatggagt---gaactggggccgcatcgtggctttcttctccttcg
A0A8C3TNF2_BCL2-01      ccgagatggggt---taactggggcagaattgtggccttcttcgagttcg
A0A8C3UEV5_MCL1-01      cagcgacggggtgaccaactggggacgagtggtgaccctcattgcctttg
                            ** **       ********  *  *  ** *  *  *    ** *

A0A8C3U920_BCL2A1-      gaggtcttctcaccaagaagcttcaagagcatggggttcagctgactgca
A0A8C3U3Q2_BCL2L1-      g------aggagccttg-tgcgtggagagcgt--------------tgtt
A0A8C3TNF2_BCL2-01      g------tggtgtgatg-tgtgtggaaagcgt--------------caac
A0A8C3UEV5_MCL1-01      gagccttcgtggccaag-cacctgaagagcat--------------caag
                        *               *     *  * *** *                  

A0A8C3U920_BCL2A1-      gaggagaaggaggagatctcttatttcatc--------------------
A0A8C3U3Q2_BCL2L1-      aaggagatgcgggtattggtgaaacgcatc-gtgtcttggatg-------
A0A8C3TNF2_BCL2-01      cgggagatgtctccgctcgtggacagcatc-gctgcctggatg-------
A0A8C3UEV5_MCL1-01      caggagcag---------------agcatcagttccctggctgggatcat
                          ****  *                 ****                    

A0A8C3U920_BCL2A1-      -acagagtacatcatcaacaacaaatccgaatggattggtgcaaatggtg
A0A8C3U3Q2_BCL2L1-      -accacgtacttgaccgaccacttagatccctggatccaggagaatggcg
A0A8C3TNF2_BCL2-01      -actgagtacctgaaccggcacctgcacaactggatccaggacaacggag
A0A8C3UEV5_MCL1-01      cacggacgccctggtgtcgtccaagcgccagtggctggagagccaggggg
                         **      * *         *         *** *        * ** *

A0A8C3U920_BCL2A1-      gctgggaaaatggcttcctaa------------------------caaag
A0A8C3U3Q2_BCL2L1-      gatggg---agcgctttgtggacctctatgggaacgatg------ctgct
A0A8C3TNF2_BCL2-01      gctggg---atgcctttgtggagttgtatggcaacagtatgaggcctttg
A0A8C3UEV5_MCL1-01      gctggg---atggctttgtgga-----------------------ctttt
                        * ****   *   ***  *                          *    

A0A8C3U920_BCL2A1-      tttgaa------agaagatcactactgtctttctccaaaattacagccct
A0A8C3U3Q2_BCL2L1-      gccgaggtg---agaaaaggccaggagaccttcaacaaatg---gctcct
A0A8C3TNF2_BCL2-01      ttcgatttctcctggatctctctgaagactatcctgagtct---ggttct
A0A8C3UEV5_MCL1-01      tccgag------tggaggac-ctggagggcagcatcaggaa---cgtgct
                           **        * *     *    *     *   *           **

A0A8C3U920_BCL2A1-      gttcatagctgttgtt-------tccttgttcagagagtactactga---
A0A8C3U3Q2_BCL2L1-      gactggggcgacggtggccggagtgcttctgctgggatcgctgctgagcc
A0A8C3TNF2_BCL2-01      ggtgggagc-----ttgcatcact------cttggcgcttatctcgg---
A0A8C3UEV5_MCL1-01      gat-ggcgt-----ttgcaggagtggctggcctgggggccagcttggcct
                        *      *      *        *         *           *    

A0A8C3U920_BCL2A1-      --------------
A0A8C3U3Q2_BCL2L1-      gcaa------gtga
A0A8C3TNF2_BCL2-01      acataa----gtag
A0A8C3UEV5_MCL1-01      acatgatccggtga
                                      

© 1998-2023Legal notice