Dataset for CDS MCL-1 of organism Propithecus coquereli

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6GI15_MCL1-01      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg
A0A2K6F6N9_MCL1-01      -------------------------------gat----------ctgtgg
A0A2K6GI15_MCL1-03      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg
                                                       **           ******

A0A2K6GI15_MCL1-01      gggggccggattgggggccggcagcagcggcgccacccccccgggagggc
A0A2K6F6N9_MCL1-01      attaacc----tggggatcagctg-----------------cgggcgggc
A0A2K6GI15_MCL1-03      gggggccggattgggggccggcagcagcggcgccacccccccgggagggc
                             **    *****  * ** *                 **** ****

A0A2K6GI15_MCL1-01      ggcttttggctgccgagaaggaggccacggcccggcgagaggtaggggga
A0A2K6F6N9_MCL1-01      agatctaggc----------------------------------------
A0A2K6GI15_MCL1-03      ggcttttggcaaccggcgccaaggacgca---------------------
                         * * * ***                                        

A0A2K6GI15_MCL1-01      ggggaagacggcacggtgattggcggaagccccggcgcaagccccccggc
A0A2K6F6N9_MCL1-01      ---------------------------------------------tgggc
A0A2K6GI15_MCL1-03      --------------------------------------aagccaatgggc
                                                                       ***

A0A2K6GI15_MCL1-01      ctccctcacgccagaagcccggagggtcgcgcggccggctcccattggtg
A0A2K6F6N9_MCL1-01      ctggctgggttt--------------------------------------
A0A2K6GI15_MCL1-03      aggtctggggccgccagcaggaaggcgctagagacc--------------
                            **                                            

A0A2K6GI15_MCL1-01      ccgaagtccccgacgtcaccgcgaccccggagaggctgctgttcttcgcg
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-03      -------ttacgacgt------------gtcggggacggtgtgcagcgca
                                                                          

A0A2K6GI15_MCL1-01      cccacccgccgcgcattgccgtccgaggagatggaagcccctgccgccga
A0A2K6F6N9_MCL1-01      -------gaag------gccttccaagg-----------catgcttcaga
A0A2K6GI15_MCL1-03      accacgagacg------gccttccaagg-----------catgcttcgga
                               *  *      *** *** ***           * ***  * **

A0A2K6GI15_MCL1-01      cgccatcatgtcgcccgaagatgagctggacgggtacgagccggagcctc
A0A2K6F6N9_MCL1-01      -----------------------aactggac--atcaaaaacgaagac--
A0A2K6GI15_MCL1-03      -----------------------aactggac--atcaaaaacgaagac--
                                               * ******   *   *  ** ** *  

A0A2K6GI15_MCL1-01      tcgggaagcggccggctgtcctgcctttg-ctggagt--tggtcggggag
A0A2K6F6N9_MCL1-01      --------------gatgtcaaatctttatcacgagtgatggtccatgtt
A0A2K6GI15_MCL1-03      --------------gatgtcaaatctttgtctcgagtgatggtccatgtt
                                      * ****    ****  *  ****  *****   *  

A0A2K6GI15_MCL1-01      gccagtaatggctccagcacggacgggtcactaccctcgacgccgccccc
A0A2K6F6N9_MCL1-01      ttcagtgacagc--------------gtaacaaact--------------
A0A2K6GI15_MCL1-03      ttcagtgacggc--------------gtaacaaact--------------
                          **** *  **              ** ** * *               

A0A2K6GI15_MCL1-01      agcagaggaggaggacgacgagttgtaccggcagtcgctggagattatct
A0A2K6F6N9_MCL1-01      ------ggggcaggattgtgactt------------------taatttct
A0A2K6GI15_MCL1-03      ------ggggcaggattgtgactc------------------taatttct
                              ** * ****    ** *                    * * ***

A0A2K6GI15_MCL1-01      ctcggtaccttcgggagcaggcaaccggcgccaaggacgcaaagccaatg
A0A2K6F6N9_MCL1-01      ttttgtgcctttgtgtccaaacacttg-----aagaccataaa-ccaaga
A0A2K6GI15_MCL1-03      tttggtgcctttgtggccaaacacttg-----aagagcataaa-ccaaga
                         *  ** **** * *  **  **   *     ***  *  *** ****  

A0A2K6GI15_MCL1-01      ggcaggtctggggccgccagcaggaaggcgctagagaccttacgacgtgt
A0A2K6F6N9_MCL1-01      gagctgcatcgaaccattagca-gaaagtatcacagacatt----cttgt
A0A2K6GI15_MCL1-03      aagctgcatcgaaccattagca-gaaagtatcacagacgtt----cttgt
                             *  * *  **   **** *** *    * **** **    * ***

A0A2K6GI15_MCL1-01      cggggacggtgtgcagcgcaaccacgagacggcctt-------------c
A0A2K6F6N9_MCL1-01      -aaggacga-------------aacgagactggcta--------------
A0A2K6GI15_MCL1-03      -aaggacaa-------------aacgagactggctagtcaaacaaagagg
                           ****                ******* * **               

A0A2K6GI15_MCL1-01      caaggatgggtttgtggagttcttccatgtagaggacctagaaggcggca
A0A2K6F6N9_MCL1-01      -------------------ttcttccatgtagaagacctggaaggcagca
A0A2K6GI15_MCL1-03      ctgggatgggtttgtggagttcttccatgtagaggacctagaaggcggca
                                           ************** ***** ****** ***

A0A2K6GI15_MCL1-01      tcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggt
A0A2K6F6N9_MCL1-01      tcagaaatgtgctgctggcttttgctggtgttgctggagtaggagctggt
A0A2K6GI15_MCL1-03      tcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggt
                        ************************* ************************

A0A2K6GI15_MCL1-01      ttggcatatctaataagatagccttgtaa
A0A2K6F6N9_MCL1-01      ttgacttatctaataagatag--------
A0A2K6GI15_MCL1-03      ttggcatatctaataagatag--------
                        *** * ***************        

© 1998-2020Legal notice