Dataset for CDS MCL-1 of organism Propithecus coquereli

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6F6N9_MCL1-01      -------------------------------gat----------ctgtgg
A0A2K6GI15_MCL1-01      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg
A0A2K6GI15_MCL1-02      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg
A0A2K6GI15_MCL1-03      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg
                                                       **           ******

A0A2K6F6N9_MCL1-01      attaacc----tggggatcagctg-----------------cgggcgggc
A0A2K6GI15_MCL1-01      gggggccggattgggggccggcagcagcggcgccacccccccgggagggc
A0A2K6GI15_MCL1-02      gggggccggattgggggccggcagcagcggcgccacccccccgggagggc
A0A2K6GI15_MCL1-03      gggggccggattgggggccggcagcagcggcgccacccccccgggagggc
                             **    *****  * ** *                 **** ****

A0A2K6F6N9_MCL1-01      agatctaggc----------------------------------------
A0A2K6GI15_MCL1-01      ggcttttggctgccgagaaggaggccacggcccggcgagaggtaggggga
A0A2K6GI15_MCL1-02      ggcttttggctgccgagaaggaggccacggcccggcgagaggtaggggga
A0A2K6GI15_MCL1-03      ggctttt-------------------------------------------
                         * * *                                            

A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-01      ggggaagacggcacggtgattggcggaagccccggcgcaagccccccggc
A0A2K6GI15_MCL1-02      ggggaagacggcacggtgattggcggaagccccggcgcaagccccccggc
A0A2K6GI15_MCL1-03      --------------------------------------------------

A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-01      ctccctcacgccagaagcccggagggtcgcgcggccggctcccattggtg
A0A2K6GI15_MCL1-02      ctccctcacgccagaagcccggagggtcgcgcggccggctcccattggtg
A0A2K6GI15_MCL1-03      --------------------------------------------------

A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-01      ccgaagtccccgacgtcaccgcgaccccggagaggctgctgttcttcgcg
A0A2K6GI15_MCL1-02      ccgaagtccccgacgtcaccgcgaccccggagaggctgctgttcttcgcg
A0A2K6GI15_MCL1-03      --------------------------------------------------

A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-01      cccacccgccgcgcattgccgtccgaggagatggaagcccctgccgccga
A0A2K6GI15_MCL1-02      cccacccgccgcgcattgccgtccgaggagatggaagcccctgccgccga
A0A2K6GI15_MCL1-03      --------------------------------------------------

A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-01      cgccatcatgtcgcccgaagatgagctggacgggtacgagccggagcctc
A0A2K6GI15_MCL1-02      cgccatcatgtcgcccgaagatgagctggacgggtacgagccggagcctc
A0A2K6GI15_MCL1-03      --------------------------------------------------

A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-01      tcgggaagcggccggctgtcctgcctttgctggagttggtcggggaggcc
A0A2K6GI15_MCL1-02      tcgggaagcggccggctgtcctgcctttgctggagttggtcggggaggcc
A0A2K6GI15_MCL1-03      --------------------------------------------------

A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-01      agtaatggctccagcacggacgggtcactaccctcgacgccgcccccagc
A0A2K6GI15_MCL1-02      agtaatggctccagcacggacgggtcactaccctcgacgccgcccccagc
A0A2K6GI15_MCL1-03      --------------------------------------------------

A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-01      agaggaggaggacgacgagttgtaccggcagtcgctggagattatctctc
A0A2K6GI15_MCL1-02      agaggaggaggacgacgagttgtaccggcagtcgctggagattatctctc
A0A2K6GI15_MCL1-03      --------------------------------------------------

A0A2K6F6N9_MCL1-01      ---------------------------------------------tgggc
A0A2K6GI15_MCL1-01      ggtaccttcgggagcaggcaaccggcgccaaggacgcaaagccaatgggc
A0A2K6GI15_MCL1-02      ggtaccttcgggagcaggcaaccggcgccaaggacgcaaagccaatgggc
A0A2K6GI15_MCL1-03      ----------------ggcaaccggcgccaaggacgcaaagccaatgggc

A0A2K6F6N9_MCL1-01      ctggctgggttt--------------------------------------
A0A2K6GI15_MCL1-01      aggtctggggccgccagcaggaaggcgctagagaccttacgacgtgtcgg
A0A2K6GI15_MCL1-02      aggtctggggccgccagcaggaaggcgctagagaccttacgacgtgtcgg
A0A2K6GI15_MCL1-03      aggtctggggccgccagcaggaaggcgctagagaccttacgacgtgtcgg
                          * *****                                         

A0A2K6F6N9_MCL1-01      ------------------------gaaggccttccaaggcatgcttcaga
A0A2K6GI15_MCL1-01      ggacggtgtgcagcgcaaccacgagacggccttccaa-------------
A0A2K6GI15_MCL1-02      ggacggtgtgcagcgcaaccacgagacggccttccaaggcatgcttcgga
A0A2K6GI15_MCL1-03      ggacggtgtgcagcgcaaccacgagacggccttccaaggcatgcttcgga
                                                ** **********             

A0A2K6F6N9_MCL1-01      aactggacatcaaaaacgaagacgatgtcaaatctttatcacgagtgatg
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg
A0A2K6GI15_MCL1-03      aactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatg

A0A2K6F6N9_MCL1-01      gtccatgttttcagtgacagcgtaacaaactggggcaggattgtgacttt
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      gtccatgttttcagtgacggcgtaacaaactggggcaggattgtgactct
A0A2K6GI15_MCL1-03      gtccatgttttcagtgacggcgtaacaaactggggcaggattgtgactct

A0A2K6F6N9_MCL1-01      aatttctttttgtgcctttgtgtccaaacacttgaagaccataaaccaag
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      aatttcttttggtgcctttgtggccaaacacttgaagagcataaaccaag
A0A2K6GI15_MCL1-03      aatttcttttggtgcctttgtggccaaacacttgaagagcataaaccaag

A0A2K6F6N9_MCL1-01      agagctgcatcgaaccattagcagaaagtatcacagacattcttgtaagg
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      aaagctgcatcgaaccattagcagaaagtatcacagacgttcttgtaagg
A0A2K6GI15_MCL1-03      aaagctgcatcgaaccattagcagaaagtatcacagacgttcttgtaagg

A0A2K6F6N9_MCL1-01      acgaaacgagactggcta--------------------------------
A0A2K6GI15_MCL1-01      -----------------------------------ggatgggtttgtgga
A0A2K6GI15_MCL1-02      acaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtgga
A0A2K6GI15_MCL1-03      acaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtgga

A0A2K6F6N9_MCL1-01      -ttcttccatgtagaagacctggaaggcagcatcagaaatgtgctgctgg
A0A2K6GI15_MCL1-01      gttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctgg
A0A2K6GI15_MCL1-02      gttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctgg
A0A2K6GI15_MCL1-03      gttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctgg
                         ************** ***** ****** *********************

A0A2K6F6N9_MCL1-01      cttttgctggtgttgctggagtaggagctggtttgacttatctaataaga
A0A2K6GI15_MCL1-01      cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
A0A2K6GI15_MCL1-02      cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
A0A2K6GI15_MCL1-03      cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
                        ******* *************************** * ************

A0A2K6F6N9_MCL1-01      tag--------
A0A2K6GI15_MCL1-01      tagccttgtaa
A0A2K6GI15_MCL1-02      tag--------
A0A2K6GI15_MCL1-03      tag--------

© 1998-2021Legal notice