Dataset for CDS BCL-2-like of organism Terrapene carolina triunguis

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A674IMR0_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Terrapene carolina triunguis GN=BCL-2 (length=702 residues).
atggctcatcctgggagaagaggctatgataaccgggagatagtgctgaagtacatccattacaaactgtcacagagggg
atatgattgggctgccaatgaaaacagaggaccagtttctccaaatctctctccccctactgttgctgggacctcatctg
accatgctgggctggtgtctctgcctcctgagccccctggctcggctgctgctagtaacgtaccccttggtgatgggctg
cgcccagcaccgcaggctgttctcttgactctgtgccaagctggagatgaattttcccgccgctaccacagagattttgc
ccagatgtctggccagctgcacttgaccccattcacggccagggggcgctttgtggcggtggtggaggagctgttccgag
atggggttaactggggaaggatcgtggccttctttgaattcggtggcgtgatgtgcgtggagagtgttaatcgggagatg
tcgcctcttgtggacagcattgctgtgtggatgaccgagtacctgaacagacacctacacaactggatccaagacaacgg
aggctgggatgcctttgtggaattgtacggcagcaacatgaggcctttgtttgatttctcctggatctctttgaagacta
tcctaagtctggctctggtgggagcttgcatcacccttggcgcttatctgggacataagtga
>gnl|bcl2dbcds|A0A674IPL6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Terrapene carolina triunguis GN=MCL-1 (length=960 residues).
atgttggcgttaaagcggaacgcggtgatcggcctcaacctgtactgcgggggcggcccgacgctgcccccctccccgcc
gggctccccgagcggcgcggggaccccccccgcccccggcgcgcgggaccccggccctccggcgacgctgattggcggag
cctcttggggtgccaacggtcattctgagggggcccgggcgctgattggctcccccgccaccccccctgcgcggggggcc
ggggggccccggccggccccgctgtggcggccggaagaggaactggacggctgcgaccccgacgccgagaggacgggccc
gccggcggccgccgcccacgccgacggctccttgcccagcaccccgcccgcggaggacgacgacgagctggacgggctgt
tccaggactcgctggagctcatcagccgctacctgcgggaggccgcggagctgggcgcgcccggcggcaagacgctcttc
aagcggctgctgagcgggccgcggggggcgggccccgccgccctggagaaggcgctggagacgctgcggagggtcggcga
cggcgtcatggagaagcaccagatcgccttccaagggatgcttcggaagctagacatcaagaatgaggaggatctgaagt
cagtgactgccgttgcaacccatgttttcagtgatggagtaacaaactggggtagaattgtgacactcatctcttttggt
gcctttgttgcaaaacacctgaagagcataaaccaggagaattgcatcaacacactagcagggatcatcacagatgtgct
tgtcacaggcaaacgagattggctagttaaccaaagaggctgggagggatttgttgaattcttccgtgtagaggatctag
aaggtagcatcaggaatgttctggtggcttttgcaggctttgctggactgggagcaagcttggcctacatgatgcgatga
>gnl|bcl2dbcds|A0A674J5J7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Terrapene carolina triunguis GN=BCL2L1 (length=690 residues).
atgtcgaacactaacagggaattagtgactgactttctctcctacaagctatcgcagcggggatacagctggagtcggtt
tgagggggaggatgagatcaggactgagtctgcagaagaggctgagatggcaagcgtccctaatgggagtccatcctggc
atccgggtgccagccacgtggtgaatggggctgccgggcacagtaacagccttgaagcccatgaaagggttccggcaact
ggagtgaggcaggcactgagagaggcaggagatgagtttgaattgaggtatcggagggctttcagtgacctcacttccca
gctccacatcacccctggcacggcataccagagctttgagcaggtggtgaatgaactcttccgggacggagtgaactggg
ggcgcattgtggcttttttctcctttggaggagccctgtgtgtggagagtgtcgacaaggagatgcaggtgttggttgga
cgcatcgtctcatggatgaccacttacctgactgaccacctagatccctggatccaagagaatggcggttgggagcggtt
tgtggatctctacgggaatgacgctgctgccaagagcaggaaaggccaggagcagttcaacaggtggcttctgaccgggg
cgactgtggcgggagtgctcctgctgggctctctgctgagccgcaagtaa
>gnl|bcl2dbcds|A0A674JQC4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Terrapene carolina triunguis GN=MCL-1 (length=456 residues).
atggagaaggtgctgaagacgctgcggagggtcggcgatggcgtcattgagaagcagcagatcgccttccaagggatgct
tcggaagctagacatcaagcatgaggaggatctgaagtcagtaactgctgttgcaacccatattttcaatgatggggtaa
caaactggggtagaattctttcgtgggtaaaaacctcacttgcatcactcatctcttttggtgcctttgttgtaaaacac
ctgaagagcataaaccaggagaattgcatcaacacactagcagggatcatcacagatgtgcttgtcacaggcaaacgaca
ttggttagttaaccaaagaggctgggagggatttgttgaattcttctgtgtagaggatctagaaggtagcagcatcagga
atgttctggtggcttttgctggactgggagaatccttggcctacatgatgcaatga
>gnl|bcl2dbcds|A0A674K8Q6_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Terrapene carolina triunguis GN=BCL2A1 (length=495 residues).
atggaacgctctgagtactgctatgtttaccatttagtccaagattatctgaaatacgttcttcaggaaccacagcttgg
accagccccaagcagagttgctcatgttttaagaactactgcatcctttctgcaaaaggaaaatgaagagagtctgaaac
catgtttggacacacttgatattacctctgtagatgctgccagaagaattttcactgaagtcgtggataaagaatttgct
gatggaaacactaactggggacggattttgacaatatttatgtttggaggaattctttctaagaggcttcaagaacacaa
agttcagcttacaggagataataaagagcagatttcttatttcatcacggagtacattataaacaacaaggctgagtgga
tagaggcaaatggaggttgggtaagtttcagtgctgtattttataaccatttttcactgttgtctagatcaggagaattt
tccttaatacattaa
© 1998-2023Legal notice