Dataset for CDS BCL-2-like of organism Terrapene carolina triunguis

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A674K8Q6_BCL2A1-      atgg----------------------------------------------
A0A674J5J7_BCL2L1-      atgtcga-------------------------------------------
A0A674IMR0_BCL2-01      atgg-----------------------------ctcatcctgggagaaga
A0A674IPL6_MCL1-01      atgttggcgttaaagcggaacgcggtgatcggcctcaacctgtactgcgg
A0A674JQC4_MCL1-01      a-------------------------------------------------
                        *                                                 

A0A674K8Q6_BCL2A1-      ------------aacgctctgagtactgctatgtttaccatttagtccaa
A0A674J5J7_BCL2L1-      ------------------------------acactaacagggaatta---
A0A674IMR0_BCL2-01      g--------------------------gctatgataaccgggagata---
A0A674IPL6_MCL1-01      gggcggcccgacgctgcccccctccccgccgggctccccgagcggcgcgg
A0A674JQC4_MCL1-01      --------------------------------------------------
                                                                          

A0A674K8Q6_BCL2A1-      gattat-----------------ctgaaatacgttcttcaggaaccacag
A0A674J5J7_BCL2L1-      --------------------gtgactgactttctctcctacaagctatcg
A0A674IMR0_BCL2-01      --------------------gtgctgaagtacatccattacaaactgtca
A0A674IPL6_MCL1-01      ggaccccccccgcccccggcgcgcgggaccccggccctccggcgacgctg
A0A674JQC4_MCL1-01      --------------------------------------------------
                                                                          

A0A674K8Q6_BCL2A1-      c-------------ttggacc-----------------------------
A0A674J5J7_BCL2L1-      cagcggggatacagctggagt-----------------------------
A0A674IMR0_BCL2-01      cagaggggatatgattgggctgccaatgaaaa---cagaggaccagtttc
A0A674IPL6_MCL1-01      attggcggagcctcttggggtgccaacggtcattctgagggggcccgggc
A0A674JQC4_MCL1-01      --------------------------------------------------
                                                                          

A0A674K8Q6_BCL2A1-      -------------------------------------------agcccca
A0A674J5J7_BCL2L1-      ------------------------cggtttgagggggaggatgagatcag
A0A674IMR0_BCL2-01      tccaaatctctctccccctactgttgct--------------gggacctc
A0A674IPL6_MCL1-01      gctgattggctcccccgccaccccccctgcgcggggggccggggggcccc
A0A674JQC4_MCL1-01      --------------------------------------------------
                                                                          

A0A674K8Q6_BCL2A1-      agcagagt------------------------------------tgctca
A0A674J5J7_BCL2L1-      gactgagtctgcagaagaggctgagat-----------ggcaagcgtccc
A0A674IMR0_BCL2-01      atctgaccatgctg------------------------ggctggtgtctc
A0A674IPL6_MCL1-01      ggccggccccgctgtggcggccggaagaggaactggacggctgcgacccc
A0A674JQC4_MCL1-01      --------------------------------------------------
                                                                          

A0A674K8Q6_BCL2A1-      tgttttaaga----------------------------------------
A0A674J5J7_BCL2L1-      taatgggag---------------------tccatcctggcatccgggtg
A0A674IMR0_BCL2-01      tgcctcctga--------------------gccccctggctcggctgctg
A0A674IPL6_MCL1-01      gacgccgagaggacgggcccgccggcggccgccgcccacgccgacggctc
A0A674JQC4_MCL1-01      --------------------------------------------------
                                                                          

A0A674K8Q6_BCL2A1-      --actactgcatcctttctgcaaaag------------------------
A0A674J5J7_BCL2L1-      ccagccacg--------tggtgaatggggctgccgggcacagtaacagcc
A0A674IMR0_BCL2-01      ctagtaacgtacccc-ttggtgatgggctgcgcccagcaccgcaggctgt
A0A674IPL6_MCL1-01      cttgcccagcaccccgcccgcggaggacgacgacgagctggacgggctgt
A0A674JQC4_MCL1-01      --------------------------------------------------
                                                                          

A0A674K8Q6_BCL2A1-      --------------------------------------------------
A0A674J5J7_BCL2L1-      t-------------------------------------------------
A0A674IMR0_BCL2-01      t-------------------------------------------------
A0A674IPL6_MCL1-01      tccaggactcgctggagctcatcagccgctacctgcgggaggccgcggag
A0A674JQC4_MCL1-01      --------------------------------------------------
                                                                          

A0A674K8Q6_BCL2A1-      --------------------------------------------------
A0A674J5J7_BCL2L1-      -------------------tgaagcccatgaaagggttccggcaactgga
A0A674IMR0_BCL2-01      ------------------------ctcttgactctg--------------
A0A674IPL6_MCL1-01      ctgggcgcgcccggcggcaagacgctcttcaagcggctgctgagcgggcc
A0A674JQC4_MCL1-01      --------------------------------------------------
                                                                          

A0A674K8Q6_BCL2A1-      ------------------------gaaaatga------------------
A0A674J5J7_BCL2L1-      gtgaggcaggcactgagagaggcaggagatgagtttgaattgaggtat--
A0A674IMR0_BCL2-01      ---------------tgccaagctggagatgaattttcccgccgctacca
A0A674IPL6_MCL1-01      gcggggggcgggccccgccgccctggagaagg----cgctggagacgctg
A0A674JQC4_MCL1-01      -----------------------tggagaagg----tgctgaagacgctg
                                                * * * *                   

A0A674K8Q6_BCL2A1-      -agagagtctgaaaccatgtt--tggacacacttgatattacctctgtag
A0A674J5J7_BCL2L1-      cggagggctttcagtgacctcacttccca-gctccacatcacccctgg--
A0A674IMR0_BCL2-01      cagagattttgcccagatgtc--tggcca-gctgcacttgaccccatt--
A0A674IPL6_MCL1-01      cggagggtcggcgacggcgtca-tgg--a-gaagcaccagatcgcctt--
A0A674JQC4_MCL1-01      cggagggtcggcgatggcgtca-ttg--a-gaagcagcagatcgcctt--
                          ***              *   *    *      *    * * *     

A0A674K8Q6_BCL2A1-      atgctgccagaagaattttca-----------ctgaagtcgtggataaag
A0A674J5J7_BCL2L1-      -cacggcataccagagctttg-----------agcaggtggtgaatgaac
A0A674IMR0_BCL2-01      -cacggccagggggcgctttg-----------tggcggtggtggaggagc
A0A674IPL6_MCL1-01      ------ccaagggatgcttcggaagctagacatcaagaatgaggaggatc
A0A674JQC4_MCL1-01      ------ccaagggatgcttcggaagctagacatcaagcatgaggaggatc
                              *          **                     * * *  *  

A0A674K8Q6_BCL2A1-      aa------------------------------tttgctgatggaaacact
A0A674J5J7_BCL2L1-      tc------------------------------ttccgggacggagt---g
A0A674IMR0_BCL2-01      tg------------------------------ttccgagatggggt---t
A0A674IPL6_MCL1-01      tgaagtcagtgactgccgttgcaacccatgttttcagtgatggagtaaca
A0A674JQC4_MCL1-01      tgaagtcagtaactgctgttgcaacccatattttcaatgatggggtaaca
                                                        **    ** **       

A0A674K8Q6_BCL2A1-      aactggggacgga------------------------ttttgacaatatt
A0A674J5J7_BCL2L1-      aactgggggcgca------------------------ttgtggctttttt
A0A674IMR0_BCL2-01      aactggggaagga------------------------tcgtggccttctt
A0A674IPL6_MCL1-01      aactggggtagaa------------------------ttgtgacactcat
A0A674JQC4_MCL1-01      aactggggtagaattctttcgtgggtaaaaacctcacttgcatcactcat
                        ********  * *                        *     *  *  *

A0A674K8Q6_BCL2A1-      tatgtttggaggaattctttctaagaggcttcaagaacacaaagttcagc
A0A674J5J7_BCL2L1-      ctcctttggagg-a------gccctgtgtgtggagagtgtcga-------
A0A674IMR0_BCL2-01      tgaattcggtgg-c------gtgatgtgcgtggagagtgttaa-------
A0A674IPL6_MCL1-01      ctcttttggtgc-ctttgttgcaaaacacctgaagagcataaa-------
A0A674JQC4_MCL1-01      ctcttttggtgc-ctttgttgtaaaacacctgaagagcataaa-------
                            ** ** *                   *  ***      *       

A0A674K8Q6_BCL2A1-      ttacaggagataa---------taaagagcag-atttcttatttcatcac
A0A674J5J7_BCL2L1-      --caaggagatgcaggtgttggttggacgcatcgtctcatggatgaccac
A0A674IMR0_BCL2-01      --tcgggagatgt---cgcctcttgtggacagcattgctgtgtggatgac
A0A674IPL6_MCL1-01      --ccaggaga-at---tgcatc-----aacacactagcagggatcatcac
A0A674JQC4_MCL1-01      --ccaggaga-at---tgcatc-----aacacactagcagggatcatcac
                             *****                   **   *  *       *  **

A0A674K8Q6_BCL2A1-      gga-gtacatt--ataaacaacaaggctgagtggatagaggcaaatggag
A0A674J5J7_BCL2L1-      ttacctgactg-----accacctagat-ccctggatccaagagaatggcg
A0A674IMR0_BCL2-01      cga-gtacctg-aacagacacctacac-aactggatccaagacaacggag
A0A674IPL6_MCL1-01      agatgtgcttgtcacaggcaa--acga-gattggctagttaaccaaagag
A0A674JQC4_MCL1-01      agatgtgcttgtcacaggcaa--acga-cattggttagttaaccaaagag
                          *  *   *        **   *       *** *        *  * *

A0A674K8Q6_BCL2A1-      gttgggtaagtttcagtgctgtatttt-----------------------
A0A674J5J7_BCL2L1-      gttgggagcggtt---tgtggatctctacgggaatgacgctgctgccaag
A0A674IMR0_BCL2-01      gctgggatgcctt---tgtggaattgt------------------acggc
A0A674IPL6_MCL1-01      gctgggagggatt---tgttgaattcttccgtgtagaggatctagaaggt
A0A674JQC4_MCL1-01      gctgggagggatt---tgttgaattcttctgtgtagaggatctagaaggt
                        * ****     **   **  *   * *                       

A0A674K8Q6_BCL2A1-      -------------ataaccattttt-------------------------
A0A674J5J7_BCL2L1-      agcaggaaaggccaggagcagttca--------------------acagg
A0A674IMR0_BCL2-01      agcaa-------catgaggcctttgtttgatttctcctggatctctttga
A0A674IPL6_MCL1-01      ---ag-------catcaggaatgt---------------------tctgg
A0A674JQC4_MCL1-01      agcag-------catcaggaatgt---------------------tctgg
                                     *  *    *                            

A0A674K8Q6_BCL2A1-      ----------cactgttgtctagatcaggag---------------aatt
A0A674J5J7_BCL2L1-      tggcttctgaccggggcgactgtggcgggag---tgctcctgctgggctc
A0A674IMR0_BCL2-01      agactatcc-taagtctggctctggtgggagcttgcatcacccttggcgc
A0A674IPL6_MCL1-01      tggcttttg-caggctttgctggactgggag-------caagcttg--gc
A0A674JQC4_MCL1-01      tggct----------tttgctggactgggag-------aatccttg--gc
                                           **      ****                   

A0A674K8Q6_BCL2A1-      ttccttaatac---attaa
A0A674J5J7_BCL2L1-      tctgctgagccgcaagtaa
A0A674IMR0_BCL2-01      ttatctgggacataagtga
A0A674IPL6_MCL1-01      ctacatgatgc---gatga
A0A674JQC4_MCL1-01      ctacatgatgc---aatga
                             *    *     * *

© 1998-2023Legal notice