Dataset for CDS BAK1 of organism Crocodylus porosus

[Download (right click)] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.8) multiple sequence alignment


A0A7M4EXH6_BAK1-02      atgtcacagctgagctcagaatacctggcctgctcgaccgagagctgttt
A0A7M4EXH6_BAK1-01      atggcctcagggaa---------------------------cagcagtga
                        *** *      **                             *** **  

A0A7M4EXH6_BAK1-02      actatcctgcagaggaggaagctgctgctgtgtccagaaacaaaggcagc
A0A7M4EXH6_BAK1-01      ccctccagggagaaggaatagc---aacgggttcggg-agaagaaacagc
                         *   *  * *** *    ***     * *  **  * *  * *  ****

A0A7M4EXH6_BAK1-02      cttaccccaaacaacccccaccgacttcctggccggggcctccagcccca
A0A7M4EXH6_BAK1-01      aatgggca------------------------------------------
                          *   *                                           

A0A7M4EXH6_BAK1-02      ccaagcaccgacttgcgtcttgcgtgcttatttgtgctcaaagcagagga
A0A7M4EXH6_BAK1-01      -------aagacgg-------------ctgtcgggga-------------
                                 ***                * *  * *              

A0A7M4EXH6_BAK1-02      ctggggcttctgctcccagagagccgaggaccaggtggctcagcagacag
A0A7M4EXH6_BAK1-01      -----------------tcaacacagaggaccaggtggctcagcagacag
                                           *   * *************************

A0A7M4EXH6_BAK1-02      aggaggtgtttcggagctatgctttctatcgctaccagcaggagagggaa
A0A7M4EXH6_BAK1-01      aggaggtgtttcggagctatgctttctatcgctaccagcaggagagggaa
                        **************************************************

A0A7M4EXH6_BAK1-02      gagagcacagaggagatgcccatggatcccgagattgccgagatccagca
A0A7M4EXH6_BAK1-01      gagagcacagaggagatgcccatggatcccgagattgccgagatccagca
                        **************************************************

A0A7M4EXH6_BAK1-02      ggagccaggcagtaccagtagcctggtgggccggcgcctggccatcatcg
A0A7M4EXH6_BAK1-01      ggagccaggcagtaccagtagcctggtgggccggcgcctggccatcatcg
                        **************************************************

A0A7M4EXH6_BAK1-02      gcgacgacatcaacgcgcggtatgacgctgagttccgcaacatgctcaag
A0A7M4EXH6_BAK1-01      gcgacgacatcaacgcgcggtatgacgctgagttccgcaacatgctcaag
                        **************************************************

A0A7M4EXH6_BAK1-02      tccttgcagcccacaaaggacaacgcctacgagtacttcacaaggatcgc
A0A7M4EXH6_BAK1-01      tccttgcagcccacaaaggacaacgcctacgagtacttcacaaggatcgc
                        **************************************************

A0A7M4EXH6_BAK1-02      ttccagcttattcgacagcggcattaactggggcagggtgattgcactgc
A0A7M4EXH6_BAK1-01      ttccagcttattcgacagcggcattaactggggcagggtgattgcactgc
                        **************************************************

A0A7M4EXH6_BAK1-02      tggggtttggctaccggatggcgatccatgtctaccagcacgggatgact
A0A7M4EXH6_BAK1-01      tggggtttggctaccggatggcgatccatgtctaccagcacgggatgact
                        **************************************************

A0A7M4EXH6_BAK1-02      ggcttcctccgaagcattgctcgctatgtggcagactttgtgctctgcaa
A0A7M4EXH6_BAK1-01      ggcttcctccgaagcattgctcgctatgtggcagactttgtgctctgcaa
                        **************************************************

A0A7M4EXH6_BAK1-02      ccgcatcgcccggtggatcgcacagcagggaggatgggtggcagcattgg
A0A7M4EXH6_BAK1-01      ccgcatcgcccggtggatcgcacagcagggaggatgggtggcagcattgg
                        **************************************************

A0A7M4EXH6_BAK1-02      acctagacaacgtttacctgaagtacatgatggtcgtgctgattgtggtc
A0A7M4EXH6_BAK1-01      acctagacaacgtttacctgaagtacatgatggtcgtgctgattgtggtc
                        **************************************************

A0A7M4EXH6_BAK1-02      ctgctgggacagttcgtggtacgtcgcttctttggacattga
A0A7M4EXH6_BAK1-01      ctgctgggacagttcgtggtacgtcgcttctttggacattga
                        ******************************************

© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice