Dataset for CDS BCL2L10 of organism Lates calcarifer

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A4W6FHH7_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Lates calcarifer GN=BCL2L10 (length=576 residues).
atgtcatgcgggctgtggaaagagaccctggttctggcagaggactacctgtgcctttgctgcacaagcccagggccagc
ccctccacctcccagcgagtcagccgctgccatgagacgcattgcccaggacatggagacacagcaccaggctcgtttcc
actcccttgctcagaccctgctgaggcagtgcgggccggacccctgctctagcctcaggaaggtgatggaggagctggtg
ggagacggacgcttgaactgggggagggttgtttcccttttcacctttactggggtgctggccagacagctgcaggagca
gaggctggggctggaccccaggcaggggcaggaactgggacaggagcccggaaactgcagggaactggcggagaccatag
ctgattaccttggagaggagaagaaagactggctgctggagaatgatggatgggaggggttctgtaagttctctcatgcc
gccagagaggtgaaccacgactcgtcgatgaagacggtgcttgttgccgctgctggcgtgggcctggctggactcacctt
cctcatggtgcgctag
© 1998-2020Legal notice