Dataset for CDS BCL-2-like of organism Neogobius melanostomus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8C6UPI9_BCL2L1-      -----------------------------------------ataatgtct
A0A8C6UWE4_BCL2L10      --------------------------------------------atgtct
A0A8C6SVR4_MCL1-02      --atgctacctgcaaaacggacaaaattcggcatccctacaacaatgttg
A0A8C6SVR4_MCL1-01      gtatgctacctgcaaaacggacaaaattcggcatccctacaacaatgttg
A0A8C6SVR4_MCL1-03      --atgctacctgcaaaacggacaaaattcggcatccctacaacaatgttg

A0A8C6UPI9_BCL2L1-      caca-----------------gtaatc-----------------------
A0A8C6UWE4_BCL2L10      tgtgggct-----------gtggaa-------------------------
A0A8C6SVR4_MCL1-02      ggtatgcttatgcctcaaaatggagtcgtggaggcggagggagctatgac
A0A8C6SVR4_MCL1-01      ggtatgcttatgcctcaaaatggagtc-----------------------
A0A8C6SVR4_MCL1-03      ggtatgcttatgcctcaaaatggagtcgtggaggcggagggagctatgac
                                             * *                          

A0A8C6UPI9_BCL2L1-      --------------------------------------------------
A0A8C6UWE4_BCL2L10      --------------------------------------------------
A0A8C6SVR4_MCL1-02      tatggacgctcgcaacggcaacggctctctcagtcactgccacccgcaac
A0A8C6SVR4_MCL1-01      --------------------------------------------------
A0A8C6SVR4_MCL1-03      tatggacgctcgcaacggcaacggctctctcagtcactgccacccgcaac

A0A8C6UPI9_BCL2L1-      ----gagagc--tggttgagttcttcctaagttacaagttaacacagaaa
A0A8C6UWE4_BCL2L10      ---agagaccc-tggctctggcag---aggactacctgt-----------
A0A8C6SVR4_MCL1-02      agcagagacccacagccctgcaagtcaagaacgaccattcaagaaagcac
A0A8C6SVR4_MCL1-01      -------acccacagccctgcaagtcaagaacgaccattcaagaaagcac
A0A8C6SVR4_MCL1-03      agcagagacccacagccctgcaagtcaagaacgaccattcaagaaagcac
                               * *    *    *             **   *           

A0A8C6UPI9_BCL2L1-      aactacccatg---------ctctctgctcatgtcagactctgctcgggt
A0A8C6UWE4_BCL2L10      ----gcctgtg---------ct-----------gcagccccca-------
A0A8C6SVR4_MCL1-02      aaaaacctacgggagggcgatt-----------acgaccacaactcgg--
A0A8C6SVR4_MCL1-01      aaaaacctacgggagggcgatt-----------acgaccacaactcgg--
A0A8C6SVR4_MCL1-03      aaaaacctacgggagggcgatt-----------acgaccacaactcgg--
                             **   *          *            *   * *         

A0A8C6UPI9_BCL2L1-      tcaatctgatggaaacaaggcagcttgt----------------gtcctg
A0A8C6UWE4_BCL2L10      ------------------ggcagcccgtcctcc------------tccca
A0A8C6SVR4_MCL1-02      ----------------acggcggctcgctcccctgcacgcccgagttcca
A0A8C6SVR4_MCL1-01      ----------------acggcggctcgctcccctgcacgcccgagttcca
A0A8C6SVR4_MCL1-03      ----------------acggcggctcgctcccctgcacgcccgagttcca
                                          *** **  *                  * *  

A0A8C6UPI9_BCL2L1-      aacggtctgctgtctaaccccaatggcagtagacgaactctgagctccca
A0A8C6UWE4_BCL2L10      gcgggtcagctgc----------tgccatgaggcg---tctgggcc----
A0A8C6SVR4_MCL1-02      gtcggaca---gt----------gaacaggagatg---tcc-ggct----
A0A8C6SVR4_MCL1-01      gtcggaca---gt----------gaacaggagatg---tcc-ggct----
A0A8C6SVR4_MCL1-03      gtcggaca---gt----------gaacaggagatg---tcc-ggct----
                           ** *    *              **  **  *   **   **     

A0A8C6UPI9_BCL2L1-      gtctcatgatcacatagaggatgttaagactgcactccgggactctgcag
A0A8C6UWE4_BCL2L10      --------aagacatggaggcccagcacaaggcacgc-------ttccac
A0A8C6SVR4_MCL1-02      --------actccgtggagaacga-cacgaggca-gc-------ttctcg
A0A8C6SVR4_MCL1-01      --------actccgtggagaacga-cacgaggca-gc-------ttctcg
A0A8C6SVR4_MCL1-03      --------actccgtggagaacga-cacgaggca-gc-------ttctcg
                                *   * * ***       *    ***  *        *    

A0A8C6UPI9_BCL2L1-      atgaatttgaagagctgttcacacaagcattcagcaac----------ct
A0A8C6UWE4_BCL2L10      ac------tctgagccaga--cct-----ttctgaaacagtgcggg--cc
A0A8C6SVR4_MCL1-02      gcgactttttcgagctaat--cacggggatttcgcagccgggttggctcc
A0A8C6SVR4_MCL1-01      gcgactttttcgagctaat--cacggggatttcgcagccgggttggctcc
A0A8C6SVR4_MCL1-03      gcgactttttcgagctaat--cacggggatttcgcagccgggttggctcc
                                   ****      *       **  * * *          * 

A0A8C6UPI9_BCL2L1-      ctcctcccaacttgacatcactcctgatacagcttatcacagctttaaaa
A0A8C6UWE4_BCL2L10      ggacccctgctccagt----ctc-----------------------agga
A0A8C6SVR4_MCL1-02      agcgacccgctttaacgacaatg-----------------------aaga
A0A8C6SVR4_MCL1-01      agcgacccgctttaacgacaatg-----------------------aaga
A0A8C6SVR4_MCL1-03      agcgacccgctttaacgacaatg-----------------------aaga
                             **              *                        *  *

A0A8C6UPI9_BCL2L1-      gcgtcatggacgag---------------------gtgttcaaagatggg
A0A8C6UWE4_BCL2L10      aggtcatggaggagc---tggtgggagatggactcttgaactggggaagg
A0A8C6SVR4_MCL1-02      gagtcgtggacaaccttttagagaaacacagaatcgcgtacaatggtagg
A0A8C6SVR4_MCL1-01      gagtcgtggacaaccttttagagaaacacagaatcgcgtacaatggtagg
A0A8C6SVR4_MCL1-03      gagtcgtggacaaccttttagagaaacacagaatcgcgtacaatggtagg
                          *** ****  *                        *  *   *   **

A0A8C6UPI9_BCL2L1-      gtcaat---------------------------------tggggacg---
A0A8C6UWE4_BCL2L10      gttg-tgtcccttttcacctttgctg-------------gggtgctggcc
A0A8C6SVR4_MCL1-02      tatgat--------aaa--caaactgtcagtggacgacagggggacgatg
A0A8C6SVR4_MCL1-01      ctgaatttgccttcaaatccaaactg-------------gggggacgatg
A0A8C6SVR4_MCL1-03      ctgaatttgccttcaaatccaaactg-------------gggggacgatg
                             *                                  ** *  *   

A0A8C6UPI9_BCL2L1-      ----------------------catatgtgta---gaaaaggacatgagc
A0A8C6UWE4_BCL2L10      agacaaatacaagag-------cagaagtgcagcaggtcagggcaggacc
A0A8C6SVR4_MCL1-02      taacgttcatgggcgacgtagccagaagtatattcgaagacggcaccacc
A0A8C6SVR4_MCL1-01      taacgttcatgggcgacgtagccagaagtatattcgaagacggcaccacc
A0A8C6SVR4_MCL1-03      taacgttcatgggcgacgtagccagaagtatattcgaagacggcaccacc
                                              ** * **  *   *   * * **  * *

A0A8C6UPI9_BCL2L1-      aatctgg--------------------ttcctcgcatcgctg--------
A0A8C6UWE4_BCL2L10      --ctggga----------------------------------------aa
A0A8C6SVR4_MCL1-02      aactggggtcggatcgccagcctgatatccttcggggcggtggtgtgcca
A0A8C6SVR4_MCL1-01      aactggggtcggatcgccagcctgatatccttcggggcggtggtgtgcca
A0A8C6SVR4_MCL1-03      aactggggtcggatcgccagcctgatatccttcggggcggtggtgtgcca

A0A8C6UPI9_BCL2L1-      --actggatgact------------atctac---------ctggatgaga
A0A8C6UWE4_BCL2L10      gtgcctgcagact---------gcaggctgc----------tggcagaaa
A0A8C6SVR4_MCL1-02      gtacctgaagtccaaaggaagggaaagctgcgtggagagagtggctgaag
A0A8C6SVR4_MCL1-01      gtacctgaagtccaaaggaagggaaagctgcgtggagagagtggctgaag
A0A8C6SVR4_MCL1-03      gtacctgaagtccaaaggaagggaaagctgcgtggagagagtggctgaag
                           *  *  * *               ** *          ***  **  

A0A8C6UPI9_BCL2L1-      atatcgcctcatggatcc---aaagccaagggggctgggactgttttgcg
A0A8C6UWE4_BCL2L10      ccatagcagattacctgggagaggagaagagagactgg--ctgttggaca
A0A8C6SVR4_MCL1-02      aaatttcctcataccttctttcagaccaacgagactgg--ctgatcagga
A0A8C6SVR4_MCL1-01      aaatttcctcataccttctttcagaccaacgagactgg--ctgatcagga
A0A8C6SVR4_MCL1-03      aaatttcctcataccttctttcagaccaacgagactgg--ctgatcagga
                          **  *    *   *           *  * * ****  *** *     

A0A8C6UPI9_BCL2L1-      caaatctttgggcaga---------------atgctgctgcagaggccag
A0A8C6UWE4_BCL2L10      atggaggctgggtaggcttctgtgagttctcatgccactccagga--agg
A0A8C6SVR4_MCL1-02      acaactcctgggatggttttgttgagtt---------ctttagag--tag
A0A8C6SVR4_MCL1-01      acaactcctgggatggttttgttgagtt---------ctttagag--tag
A0A8C6SVR4_MCL1-03      acaactcctgggatggttttgttgagtt---------ctttagag--tag
                                ****  *                      **  **      *

A0A8C6UPI9_BCL2L1-      gagatctcgggagactc-----tgaagaaatggctgctagttggagtggg
A0A8C6UWE4_BCL2L10      tggacca----ggactcatccatgaagaccgctctgtttgctgctgctgg
A0A8C6SVR4_MCL1-02      acgaccc----agaatcaaaagtgaggaacacacttatggctgtggccgg
A0A8C6SVR4_MCL1-01      acgaccc----agaatcaaaagtgaggaacacacttatggctgtggccgg
A0A8C6SVR4_MCL1-03      acgaccc----agaatcaaaagtgaggaacacacttatggctgtggccgg
                          ** *      ** **     *** **     **  * * **  *  **

A0A8C6UPI9_BCL2L1-      ---gttgctaacaggtgtgctggtcgctatgctcatcgctaggaaacagt
A0A8C6UWE4_BCL2L10      ---ggtgggtctcgctggcctcacctttctcttggtg---------cgct
A0A8C6SVR4_MCL1-02      actagcaggaatcggtgcaaccctggccatgttaatc---------aggt
A0A8C6SVR4_MCL1-01      actagcaggaatcggtgcaaccctggccatgttaatc---------aggt
A0A8C6SVR4_MCL1-03      actagcaggaatcggtgcaaccctggccatgttaatc---------aggt
                                     * **            *  *  *             *

A0A8C6UPI9_BCL2L1-      ga
A0A8C6UWE4_BCL2L10      ag
A0A8C6SVR4_MCL1-02      ga
A0A8C6SVR4_MCL1-01      ga
A0A8C6SVR4_MCL1-03      ga

© 1998-2023Legal notice