Dataset for CDS BCL-2 of organism Scleropages formosus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C9T5U7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Scleropages formosus GN=BCL-2 (length=735 residues).
atggcaaacgagggcgcgtacgacagccgggacatcgtggaagtgtacctgtaccacaagctgctcaagacgggctatgt
gtgggaattccgcgccgccgccgccgccgacgccgatccctccaataacggattaacggactccggctcgcccggcttgc
ccgggtcgcccggctcccaggtggtggcacggaggtcgcaggctgccggggccgcggacgcagaggacgcgcccctctcc
cgcagccgcgcgccccactgcgacccccgctgcgaccaccacgccgcactgcaccgggtcctgcgcgaggcgggcgacga
gatcgagcggatgtaccagcgggacttcgcgcagatgcccgagcggctgcacttcacgcccagcacggcgcagcgcaagt
tcacggccgtcatcgaggagctcttcagcgacggcgtgaactgggggcgcatcgtggcctttttcgagttcgggggcacc
atgtgcgtggagagcgtgaaccgggagatgacgtcccaggtggataacattgcgcgctggatgacggagtatctaaacgg
acccctccgtaactggatccaggaaaatggaggatgggatgccttcgtggagctctacgggcagcagaggggctccgtgt
tccgctgttcctggccgtacataaagaccgttttcggtctggccgctttgggagcggccggcgtcaccatcggggcgtac
ctcacccacaagtga
© 1998-2023Legal notice