Dataset for CDS Unclassified of organism Actinia tenebrosa

[Download (right click)]

3 sequence(s)

>gnl|bcl2dbcds|A0A6P8HJS8_uncBOK-01 Putative BCL2-related ovarian killer gene OS=[Eukaryota] Actinia tenebrosa (length=729 residues).
atgtctaccaagcttttcatgtctgcaacgaaatacttgttggtcgcggtcagacttattacagctttgtttgtaaacat
aaactcccttttaagaaagactaaggagacgcaatttatttcggatgataaaattgccttacaagctgaatacatatgcg
agaaatacatccaaaacaagtttagtcaaaaggcaaaaaccacgaaagtaatgcttcagggaaatccgcgtttgaaagct
tctgaagaaatttgctcagaagacgttgtcaccacgatgcaaaaatacggagggatcctagagaattgctttcctacgct
gtactgtaatgtcacccagcagttaaactttggcatcaacatcgatctggtcgtttgtggagtgttcacgtgtgtttgtg
ataacatacttgcaagtggcattacttggtcaaagattgtgtcaatgtatgcgtttgccgctgctcttgccacggattgt
tctcaagacaacgatcttagaattgctaagagtatttctcgctggatgggacagtatattcataagaggctatgcacttg
gatacgagaaaacggtggttgggatggattggctattcactttgacgagagtgcttgtattttcagtccaaaaagcaact
gcagctggataaacaagagagtttttactctaactgggtcacttatagcacttcttttcatgactgcagtggcattcaga
ctaagctaa
>gnl|bcl2dbcds|A0A6P8HQY7_uncBOK-01 Putative BCL2-related ovarian killer gene OS=[Eukaryota] Actinia tenebrosa (length=756 residues).
atgtcaacactgagtcgaccaacactgaataagaagcgactaagctggatagatatgactacatcatccagccaccaaaa
gattcgaataacaagaagaatcgttcaactacagcaagataaatttgcctctacgcttctcgatgaaggaaagcagctct
gttgtgagtacgtagatgctaagcttcaacgtgagggccttaagcgatcttcaggcagctactggacgtcaggttctgct
caaagtttcggagaaaattggccaacaatttctgcacgtgttcaagaagttggctggatgttagaagagtgttatccaag
gctttacacagatatttcacagcacgtcaatgtgccttttactagtgaagaagttgtccatgatttgtttcgacatgtgt
gtgcggagatattatctgacggtgttaattgggctcgtatcgtagccgtcttccagtttgcaggggctcttgctgcagag
tgttacaaggatagtagaagtgtttatgttaatgatatttctagttggatgtacgaattaacagcgatgtatctaataga
ttggatcaaacgacgaggtggctgggttgacattctgcgcgcatttcctcgttccagcatagcagattacatcatcacct
cgcgtggaagatggcgngttgtagactacctaacgaactggctgttctacgtcgttacgagattaagagaatcatcgcgc
gcttgtgtgcgcacgataggtcttagtagcgaatag
>gnl|bcl2dbcds|A0A6P8I232_uncBOK-01 Putative BCL2-related ovarian killer gene OS=[Eukaryota] Actinia tenebrosa (length=678 residues).
atgttaaagtcagttaccaaaaggctcaaacctctaatcactgcgaagctgaatgaggaatatctagccatctcaaacga
gtctaatttgtactgtctgaattacatcgaagcgcggtttaaaaggcgtaatatagaatctgggttggagttcgtgagac
cggattatgtatcagaaacaagcactaccgtctcgatcaaaattgtggaagttggatccctgctcgaagacgcttaccct
cacttattcacgaacgtttctaaacatcttcgggttagactacgaagtgaagtcgtcatcaatgaggtttttaaaacatt
tggaagggagctttttcgagatggcgcgacatgggcaaagattaccgctctttttgcgttcgcggcgtccatcagtgagg
actgtgtgctgcaaggaagacaagagcttgtcaagtgcatactgaactgtgttcggatgtatattcatgatcatctagct
gtgtggattagaaatcaaggcggatggccacagattgtagaaacgttcaagtgcatcgaaaagaggcgctcagcttactt
ttggttcatttattacatcaaatcctacgtgtattccttgacacaagaggctcaacaaaggatcaacaattcattgctgt
ccttgtacgaagtttttgagcttttaaacttcggctaa
© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice