Dataset for CDS MCL-1 of organism Anabas testudineus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q1GX28_MCL1-02      atgttaccgtcgggcagaacagctatgaaactagccacgggaggaatgag
A0A3Q1GX28_MCL1-01      atgttaccgtcgggcagaacagctatgaaactagccacgggaggaatgag

A0A3Q1GX28_MCL1-02      ctgcttgatgcttcctcaaaatggagtcgtagagtacagctcgggagtca
A0A3Q1GX28_MCL1-01      ctgcttgatgcttcctcaaaatggagtcgtagagtacagctcgggagtca

A0A3Q1GX28_MCL1-02      actcgccacagatcaccatgagctcctcgatagacgcttgcaacgggaat
A0A3Q1GX28_MCL1-01      actcgccacagatcaccatgagctcctcgatagacgcttgcaacgggaat

A0A3Q1GX28_MCL1-02      gctgctctgaaacgacccaagaacctggacgtgagctcatcgaatggcta
A0A3Q1GX28_MCL1-01      gctgctctgaaacgacccaagaacctggacgtgagctcatcgaatggcta

A0A3Q1GX28_MCL1-02      tgcaacaaaaaacattggggctaacagcgacgacatcgaagacggatctt
A0A3Q1GX28_MCL1-01      tgcaacaaaaaacattggggctaacagcgacgacatcgaagacggatctt

A0A3Q1GX28_MCL1-02      tgccgtgcaccccggagctgatgtcggacagcgaggtcgatgtctccagt
A0A3Q1GX28_MCL1-01      tgccgtgcaccccggagctgatgtcggacagcgaggtcgatgtctccagt

A0A3Q1GX28_MCL1-02      tgtccagcaggggacgaggtgctggagaacgacacgaggcagctcctaag
A0A3Q1GX28_MCL1-01      tgtccagcaggggacgaggtgctggagaacgacacgaggcagctcctaag

A0A3Q1GX28_MCL1-02      ccagtttctccaagacttttctggacttactaagcctcgttggtgtgaaa
A0A3Q1GX28_MCL1-01      ccagtttctccaagacttttctggacttactaagcctcgttggtgtgaaa

A0A3Q1GX28_MCL1-02      ccaaagaactatcaacaatgaaaagggttgtgaatgacgttctggaaaaa
A0A3Q1GX28_MCL1-01      ccaaagaactatcaacaatgaaaagggttgtgaatgacgttctggaaaaa

A0A3Q1GX28_MCL1-02      cacagatacgcgtacaatggtatgatcaacaaactctcactggatgacaa
A0A3Q1GX28_MCL1-01      cacagatacgcgtacaatggtatgatcaacaaactctcactggatgacaa

A0A3Q1GX28_MCL1-02      agtggacgatgtgagttttatcacggcagtagcccagagccttttctcag
A0A3Q1GX28_MCL1-01      agtggacgatgtgagttttatcacggcagtagcccagagccttttctcag

A0A3Q1GX28_MCL1-02      atggaaccacaaactggggtcgtatcgccagcctggtggcctttggggca
A0A3Q1GX28_MCL1-01      atggaaccacaaactggggtcgtatcgccagcctggtggcctttggggca

A0A3Q1GX28_MCL1-02      gcagtgtgtcagcacctgaaggaaaaacacagggagaactgtgtggatct
A0A3Q1GX28_MCL1-01      gcagtgtgtcagcacctgaaggaaaaacacagggagaactgtgtggatct

A0A3Q1GX28_MCL1-02      ggtggcacaggagatctcctcatacctgctgtcagcccagcgagactggc
A0A3Q1GX28_MCL1-01      ggtggcacaggagatctcctcatacctgctgtcagcccagcgagactggc

A0A3Q1GX28_MCL1-02      tggtcaggaacaactcatgggatggttttgttgaattctttcgagtggca
A0A3Q1GX28_MCL1-01      tggtcaggaacaactcatgggatggttttgttgaattctttcgagtggca

A0A3Q1GX28_MCL1-02      gaccctgaatccacagtgaggaaatcactcatggcctttgcaggattggc
A0A3Q1GX28_MCL1-01      gaccctgaatccacagtgaggaaatcactcatggcctttgcaggattggc

A0A3Q1GX28_MCL1-02      tggtattggggcatcactggccctgttgatcag----tgctgtccgactt
A0A3Q1GX28_MCL1-01      tggtattggggcatcactggccctgttgatcagctcctgtagtgtgatgt
                        *********************************    **  **  **  *

A0A3Q1GX28_MCL1-02      cagcctcttcacctgcattaa
A0A3Q1GX28_MCL1-01      ga-------------------

© 1998-2020Legal notice