Dataset for CDS Unclassified of Organism Denticeps clupeoides

[Download (right click)]

7 sequence(s)

>gnl|bcl2dbcds|A0A8C4BB70_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Denticeps clupeoides (length=606 residues).
tgtcgacgttcatgttccgcagataagcagataggagcggctgttatccaccgtgttcttcggaacgaggtggagcagag
tgtgggcaatgcggactccttccttcctgaagccacgtccttagccaatcaggatgcagagaagttgtccgtccagttag
ctgatactattcgaattatcggagaccacctggcatcacagaggatattgaatgacttgatcgatggcattcctcaacca
gatgagcgtttcttgtccaagctggcaacaaaagtgtttgctgatgggaacgtcaactggggaagaattgttgtactttt
ctacactgtggcaaagttggcagtaaagttcgtgaaggctcactttcctgagtcagtgcaaacagttcttagatggactc
agacttacttcaaggagaatctgctgaactggatcatacaagctggaggatggatcaacagcatttctgaattcacctgc
ctgcggatgactggcctgccctcactcagcgcctcacagttcctcaccacccctgtggtcctcatcaccgtcttcgcttg
tgggtttctactaggggctgtctggagaatctgcaaaaatacttga
>gnl|bcl2dbcds|A0A8C4BC20_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Denticeps clupeoides (length=693 residues).
aagttcagttcagcagaacagcctcgagtgatcggcggggaggtgcctctcctggctcagttccccttgaatgtacagta
cgagaaactggtgttcgaactcacagagaacatggagagcatttcggacacacttcgaaacaatacagagctgaacgcca
tgatcgataaaatcgctcaacaacgaaatcccgacattctcgcaaaagcagccgaaatggtgttttctgatggagtcgtc
aactgggggagaatcattgtacttctctacacagcgagaagactgtctgttaagctgtggatcgccttcgaacccgaggc
ggggctggacatcttcaccagcactcttgcctacttcaagaacatcctactggcctggattgtcaagatgggtggctggg
taacgaacgaatcaaattccgcgtcaacagcaagtaaaaccaggcctgtgcaacacgtttcatttctccttcgcttccgt
cccacagaccagcagcctctcggaattcgagcggtggcagaaaggcctggagggcatcggcctccccagagctgccgtca
ttggtggccttctgcttgccggctgtctgctgctgtggggagtggcgaggagcagctgttaaaaacatcgtgtaccaccc
cttcagtccacattttaaaatgcaccactaaaatgtatcgaagaagttcatga
>gnl|bcl2dbcds|A0A8C4BC20_uncBAX-02 Putative BCL2-associated X gene OS=[Eukaryota] Denticeps clupeoides (length=711 residues).
gtcctcagcaagggacttcccagggggcaagtgaatgaactgaagcgagtgatcggcggggaggtgcctctcctggctca
gttccccttgaatgtacagtacgagaaactggtgttcgaactcacagagaacatggagaccttcaatgcttatctgtccc
tttcacttctacacagcatgatcgataaaatcgctcaacaacgaaatcccgacattctcgcaaaagcagccgaaatggtg
ttttctgatggagtcgtcaactgggggagaatcattgtacttctctacacagcgagaagactgtctgttaagctgtggat
cgccttcgaacccgaggcggggctggacatcttcaccagcactcttgcctacttcaagaacatcctactggcctggattg
tcaagatgggtggctgggtaacgaacgaatcaaattccgcgtcaacagcaagtaaaaccaggcctgtgcaacacgtttca
tttctccttcgcttccgtcccacagaccagcagcctctcggaattcgagcggtggcagaaaggcctggagggcatcggcc
tccccagagctgccgtcattggtggccttctgcttgccggctgtctgctgctgtggggagtggcgaggagcagctgttaa
aaacatcgtgtaccaccccttcagtccacattttaaaatgcaccactaaaatgtatcgaagaagttcatga
>gnl|bcl2dbcds|A0A8C4BC20_uncBAX-03 Putative BCL2-associated X gene OS=[Eukaryota] Denticeps clupeoides (length=705 residues).
gtcctcagcaagggacttcccagggggcaagtgaatgaactgaagcgagtgatcggcggggaggtgcctctcctggctca
gttccccttgaatgtacagtacgagaaactggtgttcgaactcacagagaacatggagagcatttcggacacacttcgaa
acaatacagacatgatcgataaaatcgctcaacaacgaaatcccgacattctcgcaaaagcagccgaaatggtgttttct
gatggagtcgtcaactgggggagaatcattgtacttctctacacagcgagaagactgtctgttaagctgtggatcgcctt
cgaacccgaggcggggctggacatcttcaccagcactcttgcctacttcaagaacatcctactggcctggattgtcaaga
tgggtggctgggtaacgaacgaatcaaattccgcgtcaacagcaagtaaaaccaggcctgtgcaacacgtttcatttctc
cttcgcttccgtcccacagaccagcagcctctcggaattcgagcggtggcagaaaggcctggagggcatcggcctcccca
gagctgccgtcattggtggccttctgcttgccggctgtctgctgctgtggggagtggcgaggagcagctgttaaaaacat
cgtgtaccaccccttcagtccacattttaaaatgcaccactaaaatgtatcgaagaagttcatga
>gnl|bcl2dbcds|A0A8C4C9V0_uncBCLWAV-01 Putative BCL2 homolog found in water-living anamniote vertebrates gene OS=[Eukaryota] Denticeps clupeoides (length=606 residues).
atggtcatgtcagaaaagcctgcaggcagccatgggctccacagcacagaccggctggtgagggagggctaccaaatggc
ctatgactatgtcaactacgtcacagccaagcccggcttcccgccaccacccgctccatgtccagctgcagctgctttga
ggcacgccggggatgagctcctcgcccgcttccccatcttcttccgccgatggccccgggttttccaggacgtcaacgag
aactcagcttgctcaacgctcattgccattctggatgaacactttgcccccaccacctccagagggcgccgtagagacct
ggcttggagcgctgtgctatctgtgtacgtcctggctgggcagatggccctgcattgtcataacagtggcatggaagcgg
ttctgccccagatacaggagtgtgtgggagggtatgtggagagagtgatatgccccgagctccgggataagggaggatgg
tctggatttgtgactcgtttcggagagaaacctaatttggaaggagaagtgaagaaggtgtgctgctggactttgctcat
cttcagcaccggcattctcatttatttcttatggagaagagattga
>gnl|bcl2dbcds|A0A8C4CCC7_uncBCLWAV-01 Putative BCL2 homolog found in water-living anamniote vertebrates gene OS=[Eukaryota] Denticeps clupeoides (length=381 residues).
atgagctcctcacccacttccccatccaaggtttttcaggacgtcaacaagaactctccttgcttgatgctcatcgtcat
tctggatgaacactttgcccccgccacctctggagggcgccgtagagacctggcttggagcgccgtgctatctgtgtacg
tcctggctgggcagatggccctgcattgtcataacagtggcatggaagcggttctgccccagatacaggagtgtgtgggg
ggatatatcgagagagtgatatgcccagagctctgggataagggatctggttttgtgactcgttttggaaagaaacctac
tttggaaggagaagtgaagaaggtcattcttatttatttcttatggaagagcagagattga
>gnl|bcl2dbcds|A0A8C4CCU8_uncBCLWAV-01 Putative BCL2 homolog found in water-living anamniote vertebrates gene OS=[Eukaryota] Denticeps clupeoides (length=522 residues).
atggtcatgtcagaaaagcctgcaggcggccatgggctccacagcacagaccggctggtgagggagggctaccaaatggc
ctatgactatgtcaactacgtcacagccaagcccggcttcccgccaccacccgctccatgtccagctgcagctgctttga
ggcacgccggggatgagctcctcgccccttgctcaacgctcgtcgccattctggatgaacactttgcccccacctccaga
gggcgccgtagagacctggcttggagcgccgtgctatctgtgtacgtcctggctgggcagatggccctgcattgtcataa
cagtggcatggaagcggttctgccccagatacaggagtgtgtgggagggtatgtggagagtgatatgccccgaaaaacta
atttggaaggagaagtgaagaaggtgtgctgctggacttcgcttcagcattctcatttatttcttatggaggaaaaaaga
ttgacattttgcccccaatgttacactccgggttgtaggtaa
© 1998-2023Legal notice