Dataset for CDS BAX-like of Organism Ficedula albicollis

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|U3JLA0_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Ficedula albicollis GN=BOK (length=642 residues).
atggaggtgctgcgccgctcctcagtctttgctgcagaggtgatggaggtttttgacaggtctcccactgacaaagagct
tgtgtcccaagccaaggctctctgcagagactacataaactcaaggctgattcaggcaggtgtcagctggagcaaacccg
agcacaacgccccagtgcctgggggcaagctggccgaggtgtccaccatactgctgagacttggggatgagctggagtac
attcgccccaacgtctacaggaacatcgcccgccagctgaacatctctctgcactctgagaccgtggtgtctgacgcctt
cctggcagtggctgcacagattttcactgcaggcataacgtggggcaaggtggtgtctctgtacgccgtggcagccgggc
tggccgtggactgcgtgcggcacgcgcagccagccatggttcacaccatcgtggactgcctgggagagtttgtgaggaag
accttggtgacgtggctgaaaaggagaggaggctgggcagacatcaccaagtgcgtggtgaatactgaccccagccttcg
ctcccactggctcgtggctgctgtttgcagttttggtcacttcctcaaggccatcttctttgtcctgctgcctgagagat
ga
>gnl|bcl2dbcds|U3JMQ7_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Ficedula albicollis GN=BAK1 (length=630 residues).
atggcctcggggaatgagggggaccctccacagctggaggaacgccgggggagccacaggcgccggctcagctcagaggg
ccgggtggcggaggaggctgaggaggtgttcaggagctacgccttccaccgctaccagcaggagcgccaggagcgagggg
cagagctgccgcccgaccccgagatcgagcaaatccagcaggacctggacagcaccggcagccaggtggggcagcgcttg
gccatcatcggcgatgacatctaccggcgctacgacgccgagttccgcaccatgctggagagcctgcagcccacccgcga
caacgcctacgagaacttcaccaaaatcgcctccagcggcatcaactggggccgggtgatcgccctgctggcctttggct
accgcctggccatgcacgtgtggcagcgcggggtcagcggcttcctgcggcgcatcgcgcagcacctggcgcagttcatg
ctgcagaaccgcatcgcccgctggatcgcccagcagggaggatggagggccgcgctgcgccgctacaacgaagtttacat
caagtacctgctggtggccgccgcggtgctgctggcacacctggcggtgcggcgcttcctcacctcctga
© 1998-2023Legal notice