Dataset for CDS Unclassified of organism Timema bartmani

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A7R9F317_uncBCL2L1-02 Putative BCL2-like 1 gene OS=[Eukaryota] Timema bartmani (length=783 residues).
atgactcctaggaataatactccaagtgttcaaatgaaagcagcagaggaggaaggaacacaaactgaagaaatcaagat
ttccacactatcaagacaatcctcaagctcaagtgatagtgacggcaactctcaaacagattccgattattttagtcatg
tcgacacggatgatgatggttctattgttcattcattgcagaaaactgttttaagtattttttctgatgaaaaatttcac
aaagccactcaaacatatgttaatccaatcgaagcaaaagcacaaagcttagctttagatgtggtgttgtatttgctaaa
agaagacatggacctcattcaagatgatcctgtgtcattatgtgtcaggaattgtgttgtagaaatgcttgacaaacata
atattttgtttaatagcatggtggataacttgaaagtgactccagaaactggttatggtgtcattacaagtgtggcggat
cagttgttttgcaatggcgaaataaattggggtcgcattattactttttatgcatttgcaggttgtctggcattgtactg
tcagaaaaaaaatatgcataaactagccagaagaattccacgattaatggatgacaccattgagaaacaaatagttccat
ttgttaaatatactggaggctgggaaagactgtgccgagaatttcctttgaaagaagacgttgatggcaaagtgtggcga
ggcttgcttatcactggaacaggtttagctttggccgctgctttgatagctcttcattcgtga
© 1998-2023Legal notice