Dataset for CDS MCL-1 of organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q8HYS5_MCL1-01      atgtttggcctcaagagaaacgcagtaatccggactcaa-ctctactgtgggggggccgg
F1PAP1_MCL1-01      atgttcggcctcaagagaaacgcagtaat-cggactcaacctctactgtgggggggccgg
F1PAP1_MCL1-02      atgttcggcctcaagagaaacgcagtaat-cggactcaacctctactgtgggggggccgg
                    ***** *********************** ********* ********************

Q8HYS5_MCL1-01      gctgggggccggcagcggcggcgcctcctcttcgggagggcggcttttggcttcggggag
F1PAP1_MCL1-01      gctgggggccggcagcggcggcgcctcctcttcgggagggcggcttttggcttcggggaa
F1PAP1_MCL1-02      gctgggggccggcagcggcggcgcctcctcttcgggagggcggctttt------------
                    ************************************************            

Q8HYS5_MCL1-01      ggaggccacgaccagacgggagggagggggaggggaagccggtgcggtgattggcggaag
F1PAP1_MCL1-01      ggaggccacgaccagacgggagggagggggaggggaagccggtgcggtgattggcggaag
F1PAP1_MCL1-02      ------------------------------------------------------------
                                                                                

Q8HYS5_MCL1-01      cgccggcgcaagtcccccgaccactctggcgccggacgcccggagggtcgcgcggccctc
F1PAP1_MCL1-01      cgccggcgcaagtcccccgaccactctggcgccggacgcccggagggtcgcgcggccctc
F1PAP1_MCL1-02      ------------------------------------------------------------
                                                                                

Q8HYS5_MCL1-01      acccattggcgctgagggccccaacgtcagcgcgacccccccgaggctgctgctgctcgc
F1PAP1_MCL1-01      acccattggcgctgagggccccaacgtcagcgcgacccccccgaggctgctgctgctcgc
F1PAP1_MCL1-02      ------------------------------------------------------------
                                                                                

Q8HYS5_MCL1-01      gcccccctgccgcgcgtcgccgcctgaagagatggaaggcccggccgccgacgccatcat
F1PAP1_MCL1-01      gcccccctgccgcgcgtcgccgcctgaagagatggaaggcccggccgccgacgccatcat
F1PAP1_MCL1-02      ------------------------------------------------------------
                                                                                

Q8HYS5_MCL1-01      gtcgcccgaagaggagctagacgggtacgagccggaacctttggggaagcggccggcggt
F1PAP1_MCL1-01      gtcgcccgaagaggagctagacgggtacgagccggaacctttggggaagcggccggcggt
F1PAP1_MCL1-02      ------------------------------------------------------------
                                                                                

Q8HYS5_MCL1-01      cctgcctctgctggagctggtgggggaggccagcagtggccccggcatggacggctcgct
F1PAP1_MCL1-01      cctgcctctgctggagttggtgggggaggccagcagtggccccggcatggacggctcgct
F1PAP1_MCL1-02      ------------------------------------------------------------
                                                                                

Q8HYS5_MCL1-01      accctcgacgccacccccggcggaggaggaggaagatgagttgtaccggcagtccctgga
F1PAP1_MCL1-01      accctcgacgccacccccggcggaggaggaggaagatgagttgtaccggcagtccctgga
F1PAP1_MCL1-02      ------------------------------------------------------------
                                                                                

Q8HYS5_MCL1-01      gattatctctcggtaccttcgggaacaggccacaggcgccaaggacgcgaaaccactggg
F1PAP1_MCL1-01      gattatctctcggtaccttcgggaacaggccacaggcgccaaggacgcgaaaccactggg
F1PAP1_MCL1-02      ---------------------------ggccacaggcgccaaggacgcgaaaccactggg
                                               *********************************

Q8HYS5_MCL1-01      cgggtctcgggcggccagccggaaggcgttagagaccctccagcgagtcggggacggggt
F1PAP1_MCL1-01      cgggtctcgggcggccagccggaaggcgttagagaccctccggcgagtcggggacggggt
F1PAP1_MCL1-02      cgggtctcgggcggccagccggaaggcgttagagaccctccggcgagtcggggacggggt
                    ***************************************** ******************

Q8HYS5_MCL1-01      acagcgcaaccacgagacagccttccaaggcatgcttcggaaactggacatcaaaaacga
F1PAP1_MCL1-01      acagcgcaaccacgagacagccttccaaggcatgcttcggaaactggacatcaaaaacga
F1PAP1_MCL1-02      acagcgcaaccacgagacagccttccaaggcatgcttcggaaactggacatcaaaaacga
                    ************************************************************

Q8HYS5_MCL1-01      agacgatgtcaaatcgttgtctcgagtgattgtccatgttttcagtgacggagtaacaaa
F1PAP1_MCL1-01      agacgatgtcaaatcgttgtctcgagtgattgtccatgttttcagtgacggagtaacaaa
F1PAP1_MCL1-02      agacgatgtcaaatcgttgtctcgagtgattgtccatgttttcagtgacggagtaacaaa
                    ************************************************************

Q8HYS5_MCL1-01      ctggggcaggattgtgactcttatttcctttggtgcctttgtggccaaacacttgaagag
F1PAP1_MCL1-01      ctggggcaggattgtgactcttatttcctttggtgcctttgtggccaaacacttgaagag
F1PAP1_MCL1-02      ctggggcaggattgtgactcttatttcctttggtgcctttgtggccaaacacttgaagag
                    ************************************************************

Q8HYS5_MCL1-01      tataaaccaagaaagctgcatcgaaccattagcagaaagcatcacagatgttctcgtaag
F1PAP1_MCL1-01      tataaaccaagaaagctgcatcgaaccattagcagaaagcatcacagatgttctcgtaag
F1PAP1_MCL1-02      tataaaccaagaaagctgcatcgaaccattagcagaaagcatcacagatgttctcgtaag
                    ************************************************************

Q8HYS5_MCL1-01      gacgaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttcca
F1PAP1_MCL1-01      gacgaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttcca
F1PAP1_MCL1-02      gacgaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttcca
                    ************************************************************

Q8HYS5_MCL1-01      tgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
F1PAP1_MCL1-01      tgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
F1PAP1_MCL1-02      tgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
                    ****************** *****************************************

Q8HYS5_MCL1-01      agtaggagctggtttggcatatctaataagatag
F1PAP1_MCL1-01      agtaggagctggtttggcatatctaataagatag
F1PAP1_MCL1-02      agtaggagctggtttggcatatctaataagatag
                    **********************************

© 1998-2020Legal notice