Dataset for CDS MCL-1 of organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q8HYS5_MCL1-01          atgtttggcctcaagagaaacgcagtaatccggactcaa-ctctactgtg
A0A5F4BWG4_MCL1-01      atgttcggcctcaagagaaacgcagtaat-cggactcaacctctactgtg
A0A5F4BWG4_MCL1-02      atgttcggcctcaagagaaacgcagtaat-cggactcaacctctactgtg
                        ***** *********************** ********* **********

Q8HYS5_MCL1-01          ggggggccgggctgggggccggcagcggcggcgcctcctcttcgggaggg
A0A5F4BWG4_MCL1-01      ggggggccgggctgggggccggcagcggcggcgcctcctcttcgggaggg
A0A5F4BWG4_MCL1-02      ggggggccgggctgggggccggcagcggcggcgcctcctcttcgggaggg
                        **************************************************

Q8HYS5_MCL1-01          cggcttttggcttcggggagggaggccacgaccagacgggagggaggggg
A0A5F4BWG4_MCL1-01      cggcttttggcttcggggaaggaggccacgaccagacgggagggaggggg
A0A5F4BWG4_MCL1-02      cggctttt------------------------------------------
                        ********                                          

Q8HYS5_MCL1-01          aggggaagccggtgcggtgattggcggaagcgccggcgcaagtcccccga
A0A5F4BWG4_MCL1-01      aggggaagccggtgcggtgattggcggaagcgccggcgcaagtcccccga
A0A5F4BWG4_MCL1-02      --------------------------------------------------
                                                                          

Q8HYS5_MCL1-01          ccactctggcgccggacgcccggagggtcgcgcggccctcacccattggc
A0A5F4BWG4_MCL1-01      ccactctggcgccggacgcccggagggtcgcgcggccctcacccattggc
A0A5F4BWG4_MCL1-02      --------------------------------------------------
                                                                          

Q8HYS5_MCL1-01          gctgagggccccaacgtcagcgcgacccccccgaggctgctgctgctcgc
A0A5F4BWG4_MCL1-01      gctgagggccccaacgtcagcgcgacccccccgaggctgctgctgctcgc
A0A5F4BWG4_MCL1-02      --------------------------------------------------
                                                                          

Q8HYS5_MCL1-01          gcccccctgccgcgcgtcgccgcctgaagagatggaaggcccggccgccg
A0A5F4BWG4_MCL1-01      gcccccctgccgcgcgtcgccgcctgaagagatggaaggcccggccgccg
A0A5F4BWG4_MCL1-02      --------------------------------------------------
                                                                          

Q8HYS5_MCL1-01          acgccatcatgtcgcccgaagaggagctagacgggtacgagccggaacct
A0A5F4BWG4_MCL1-01      acgccatcatgtcgcccgaagaggagctagacgggtacgagccggaacct
A0A5F4BWG4_MCL1-02      --------------------------------------------------
                                                                          

Q8HYS5_MCL1-01          ttggggaagcggccggcggtcctgcctctgctggagctggtgggggaggc
A0A5F4BWG4_MCL1-01      ttggggaagcggccggcggtcctgcctctgctggagttggtgggggaggc
A0A5F4BWG4_MCL1-02      --------------------------------------------------
                                                                          

Q8HYS5_MCL1-01          cagcagtggccccggcatggacggctcgctaccctcgacgccacccccgg
A0A5F4BWG4_MCL1-01      cagcagtggccccggcatggacggctcgctaccctcgacgccacccccgg
A0A5F4BWG4_MCL1-02      --------------------------------------------------
                                                                          

Q8HYS5_MCL1-01          cggaggaggaggaagatgagttgtaccggcagtccctggagattatctct
A0A5F4BWG4_MCL1-01      cggaggaggaggaagatgagttgtaccggcagtccctggagattatctct
A0A5F4BWG4_MCL1-02      --------------------------------------------------
                                                                          

Q8HYS5_MCL1-01          cggtaccttcgggaacaggccacaggcgccaaggacgcgaaaccactggg
A0A5F4BWG4_MCL1-01      cggtaccttcgggaacaggccacaggcgccaaggacgcgaaaccactggg
A0A5F4BWG4_MCL1-02      -----------------ggccacaggcgccaaggacgcgaaaccactggg
                                         *********************************

Q8HYS5_MCL1-01          cgggtctcgggcggccagccggaaggcgttagagaccctccagcgagtcg
A0A5F4BWG4_MCL1-01      cgggtctcgggcggccagccggaaggcgttagagaccctccggcgagtcg
A0A5F4BWG4_MCL1-02      cgggtctcgggcggccagccggaaggcgttagagaccctccggcgagtcg
                        ***************************************** ********

Q8HYS5_MCL1-01          gggacggggtacagcgcaaccacgagacagccttccaaggcatgcttcgg
A0A5F4BWG4_MCL1-01      gggacggggtacagcgcaaccacgagacagccttccaaggcatgcttcgg
A0A5F4BWG4_MCL1-02      gggacggggtacagcgcaaccacgagacagccttccaaggcatgcttcgg
                        **************************************************

Q8HYS5_MCL1-01          aaactggacatcaaaaacgaagacgatgtcaaatcgttgtctcgagtgat
A0A5F4BWG4_MCL1-01      aaactggacatcaaaaacgaagacgatgtcaaatcgttgtctcgagtgat
A0A5F4BWG4_MCL1-02      aaactggacatcaaaaacgaagacgatgtcaaatcgttgtctcgagtgat
                        **************************************************

Q8HYS5_MCL1-01          tgtccatgttttcagtgacggagtaacaaactggggcaggattgtgactc
A0A5F4BWG4_MCL1-01      tgtccatgttttcagtgacggagtaacaaactggggcaggattgtgactc
A0A5F4BWG4_MCL1-02      tgtccatgttttcagtgacggagtaacaaactggggcaggattgtgactc
                        **************************************************

Q8HYS5_MCL1-01          ttatttcctttggtgcctttgtggccaaacacttgaagagtataaaccaa
A0A5F4BWG4_MCL1-01      ttatttcctttggtgcctttgtggccaaacacttgaagagtataaaccaa
A0A5F4BWG4_MCL1-02      ttatttcctttggtgcctttgtggccaaacacttgaagagtataaaccaa
                        **************************************************

Q8HYS5_MCL1-01          gaaagctgcatcgaaccattagcagaaagcatcacagatgttctcgtaag
A0A5F4BWG4_MCL1-01      gaaagctgcatcgaaccattagcagaaagcatcacagatgttctcgtaag
A0A5F4BWG4_MCL1-02      gaaagctgcatcgaaccattagcagaaagcatcacagatgttctcgtaag
                        **************************************************

Q8HYS5_MCL1-01          gacgaaacgagactggctagtcaaacaaagaggctgggatgggtttgtgg
A0A5F4BWG4_MCL1-01      gacgaaacgagactggctagtcaaacaaagaggctgggatgggtttgtgg
A0A5F4BWG4_MCL1-02      gacgaaacgagactggctagtcaaacaaagaggctgggatgggtttgtgg
                        **************************************************

Q8HYS5_MCL1-01          agttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctg
A0A5F4BWG4_MCL1-01      agttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctg
A0A5F4BWG4_MCL1-02      agttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctg
                        **************************** *********************

Q8HYS5_MCL1-01          gcttttgcaggtgttgctggagtaggagctggtttggcatatctaataag
A0A5F4BWG4_MCL1-01      gcttttgcaggtgttgctggagtaggagctggtttggcatatctaataag
A0A5F4BWG4_MCL1-02      gcttttgcaggtgttgctggagtaggagctggtttggcatatctaataag
                        **************************************************

Q8HYS5_MCL1-01          atag
A0A5F4BWG4_MCL1-01      atag
A0A5F4BWG4_MCL1-02      atag
                        ****

© 1998-2021Legal notice