Dataset for CDS BAX-like of Organism Haplochromis burtoni

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q2UWG8_BOK-01      ------------------atg-----------------------------
A0A3Q2VJY7_BAX-01      ------------------gcaata--------------------------
A0A3Q2VJY7_BAX-02      tactcggacttttacaccatgaccgctgctgtgatttggt----------
A0A3Q2VJY7_BAX-03      ------------------atgacc--------------------------
A0A3Q3C2Q2_BAX-01      --------------------------------------------------
A0A3Q3CU65_BAX-01      ------------------acccc---------------------------
A0A3Q2V329_BAX-01      ------------------atggcatcacacccgggaggaggcgatcaagg
A0A3Q2V329_BAX-02      ------------------atg-----------------------------
                                                                         

A0A3Q2UWG8_BOK-01      -----------------------gaggtcct-------------------
A0A3Q2VJY7_BAX-01      ---tgcaaaacatgcaa-gaagagaatcacag----acagagat------
A0A3Q2VJY7_BAX-02      -gttgtttgaagtttactgaggagaatctttgtataataaaatt------
A0A3Q2VJY7_BAX-03      ---tgctctacttcctgtgatgcaaatctttgtataataaaatt------
A0A3Q3C2Q2_BAX-01      --------------------------------------------------
A0A3Q3CU65_BAX-01      -catgtc--cccctgcatgccacggggtcctggttggcccaacttgccct
A0A3Q2V329_BAX-01      tagtggcagctatcgtcaacaaataaaatacatatatttcgact------
A0A3Q2V329_BAX-02      -agtgtctacctttgtctttcagggaattccggaga-tcagata------
                                                                         

A0A3Q2UWG8_BOK-01      ------------gcgcaggtcttcagtgtttgctg-------cagaggtc
A0A3Q2VJY7_BAX-01      ------------ggaacaacttccaactttgtccgacagttgaagactgt
A0A3Q2VJY7_BAX-02      ------------gtgggtgttttt--ttttgtctg---------------
A0A3Q2VJY7_BAX-03      ------------gtgggtgttttt--ttttgtctg---------------
A0A3Q3C2Q2_BAX-01      ---------------atggcttac--tgttgtgta---------------
A0A3Q3CU65_BAX-01      ctttacctggcagtcctcggctgc--cctcgggtc---------------
A0A3Q2V329_BAX-01      ------ctgacagt-atggcttac--tgttgtgta---------------
A0A3Q2V329_BAX-02      ------ctggaagt-cggaacta---------------------------
                                            *                            

A0A3Q2UWG8_BOK-01      ctggatgtgtttgaccg-atcactgaccgagaaggagctggtgacccagt
A0A3Q2VJY7_BAX-01      ctttatgtatgtgattgcacatataaacacagaggagcccagtc-----g
A0A3Q2VJY7_BAX-02      ctacaggtatgtgattgcacatataaacacagaggagcccagtc-----g
A0A3Q2VJY7_BAX-03      ctacaggtatgtgattgcacatataaacacagaggagcccagtc-----g
A0A3Q3C2Q2_BAX-01      tttgtgctgtatagtttcatctatgagc------gagttcagaggcaaag
A0A3Q3CU65_BAX-01      ctttatttcccgtctctcct-----------------------------g
A0A3Q2V329_BAX-01      tttgtgctgtatagtttcatctatgagc------gagttcagaggcaagg
A0A3Q2V329_BAX-02      -ttttgttacaggatttcatctatgagc------gagttcagaggcaagg
                        *     *                                          

A0A3Q2UWG8_BOK-01      ctaaggcgct------gtgcagagactacatcttgtcgaggctcaaccaa
A0A3Q2VJY7_BAX-01      acacgtgacttctgaggatttgggaggaaggccagatgaacaacag----
A0A3Q2VJY7_BAX-02      acacgtgacttctgaggatttgggaggaaggccagatgaacaacag----
A0A3Q2VJY7_BAX-03      acacgtgacttctgaggatttgggaggaaggccagatgaacaacag----
A0A3Q3C2Q2_BAX-01      agatggcaatagggcagtgacgagagaacagcttgatggaagccagctga
A0A3Q3CU65_BAX-01      atatgactttaa-------------------------------------a
A0A3Q2V329_BAX-01      agatggcaataatgcagtgacgagagaacagcttggtggaagccagctga
A0A3Q2V329_BAX-02      agatggcaataatgcagtgacgagagaacagcttggtggaagccagctga
                         * *    *                                        

A0A3Q2UWG8_BOK-01      aacgggttgggatggtctaaaactgaactccatttttctccctcaaacgc
A0A3Q2VJY7_BAX-01      -------------gatccacaagtcaa-----------------------
A0A3Q2VJY7_BAX-02      -------------gatccacaagtcaa-----------------------
A0A3Q2VJY7_BAX-03      -------------gatccacaagtcaa-----------------------
A0A3Q3C2Q2_BAX-01      -----------ctgacccaaaacataa-----------------------
A0A3Q3CU65_BAX-01      -----------tggacct---gcatta-----------------------
A0A3Q2V329_BAX-01      -----------ctgacccaaaacataa-----------------------
A0A3Q2V329_BAX-02      -----------ctgacccaaaacataa-----------------------
                                    *  *         *                       

A0A3Q2UWG8_BOK-01      agcgctggctgaagtgtctatggtgcttctctgtcttggcgatgagctgg
A0A3Q2VJY7_BAX-01      agaagtggtagaa-cagctgcgc--------aagatagccgacagtttaa
A0A3Q2VJY7_BAX-02      agaagtggtagaa-cagctgcgc--------aagatagccgacagtttaa
A0A3Q2VJY7_BAX-03      agaagtggtagaa-cagctgcgc--------aagatagccgacagtttaa
A0A3Q3C2Q2_BAX-01      gaagcttgctcag-tgcctgcag--------catattggagacgagctgg
A0A3Q3CU65_BAX-01      aaagtccatttaa-tgc---------------------------------
A0A3Q2V329_BAX-01      gaagcttgctcag-tgcctgcag--------cagattggagatgagctgg
A0A3Q2V329_BAX-02      gaagcttgctcag-tgcctgcag--------cagattggagatgagctgg
                                  *                                      

A0A3Q2UWG8_BOK-01      agtgtatacagcccagtttgtacaggaacgtggcacggcagctcaacatt
A0A3Q2VJY7_BAX-01      accgca-----------atgctgagcttcagagactgataaaccaggttc
A0A3Q2VJY7_BAX-02      accgca-----------atgctgagcttcagagactgataaaccaggttc
A0A3Q2VJY7_BAX-03      accgca-----------atgctgagcttcagagactgataaaccaggttc
A0A3Q3C2Q2_BAX-01      atggaa-----------atgtagagctccaaagaatgataaataactctt
A0A3Q3CU65_BAX-01      -----------------------aggtccaaagaatgataaatgactctt
A0A3Q2V329_BAX-01      atggaa-----------atgtagagctccaaagaatgataaatgactctt
A0A3Q2V329_BAX-02      atggaa-----------atgtagagctccaaagaatgataaatgactctt
                                              **   *   *   *  *    *   * 

A0A3Q2UWG8_BOK-01      tctgttgccatggagaacatggtttc-----ggatgccttcatcggtgta
A0A3Q2VJY7_BAX-01      ----------aggggaactgcgttc-----aagatgtcttcatggcagtt
A0A3Q2VJY7_BAX-02      ----------aggggaactgcgttc-----aagatgtcttcatggcagtt
A0A3Q2VJY7_BAX-03      ----------aggggaactgcgttc-----aagatgtcttcatggcagtt
A0A3Q3C2Q2_BAX-01      ----------cg-----ctttgtcccacaagaaaggtttttatgagagtg
A0A3Q3CU65_BAX-01      ----------cg-----ctttgtcccacaagagaggtttttatgagagtg
A0A3Q2V329_BAX-01      ----------cg-----ctttgtcccacaagagaggtttttatgagagtg
A0A3Q2V329_BAX-02      ----------cg-----ctttgtcccacaagagaggtttttatgagagtg
                                  *     *   **          * *  ** **    ** 

A0A3Q2UWG8_BOK-01      gcaacagagattttctcagcaggca---taacatggggtaaggtggtgtc
A0A3Q2VJY7_BAX-01      gcaagaaacatctttgctgatggca---tcaactggggtcgagtagtggc
A0A3Q2VJY7_BAX-02      gcaagaaacatctttgctgatggca---tcaactggggtcgagtagtggc
A0A3Q2VJY7_BAX-03      gcaagaaacatctttgctgatggca---tcaactggggtcgagtagtggc
A0A3Q3C2Q2_BAX-01      gcctctgagatcttttcagatggaatatttaactggggcagggtggttgc
A0A3Q3CU65_BAX-01      gcctatgagatcttttcagatggaatatttaactggggcagggaggttgc
A0A3Q2V329_BAX-01      gcctatgagatcttttcagatggaatatttaactggggcagggaggttgc
A0A3Q2V329_BAX-02      gcctatgagatcttttcagatggaatatttaactggggcagggaggttgc
                       **     * ** **  * *  ** *   * *  *****    *  **  *

A0A3Q2UWG8_BOK-01      catgtttgcggtagctggagccctggcagtggactgtgtcagacaaggcc
A0A3Q2VJY7_BAX-01      tctcttcc-----------atctggcctgtaaact-tatac-acaaggct
A0A3Q2VJY7_BAX-02      tctcttcc-----------atctggcctgtaaact-tatac-acaaggct
A0A3Q2VJY7_BAX-03      tctcttcc-----------atctggcctgtaaact-tatac-acaaggct
A0A3Q3C2Q2_BAX-01      actgttct-----------actttgcatgccgact-cgtta-tcaaagta
A0A3Q3CU65_BAX-01      actgttct-----------actttgcatgccgact-cgtta-tcaaagct
A0A3Q2V329_BAX-01      actgttct-----------actttgcatgccgact-cgtta-tcaaagct
A0A3Q2V329_BAX-02      actgttct-----------actttgcatgccgact-cgtta-tcaaagct
                         * **                  *   *   ***   *    *** *  

A0A3Q2UWG8_BOK-01      atccggctacagtgcacatcttagtggacagtctgggacagtttgtccgc
A0A3Q2VJY7_BAX-01      at-----taccgccaatcacttagagaaca-tccaaatga--tcatcagc
A0A3Q2VJY7_BAX-02      at-----taccgccaatcacttagagaaca-tccaaatga--tcatcagc
A0A3Q2VJY7_BAX-03      at-----taccgccaatcacttagagaaca-tccaaatga--tcatcagc
A0A3Q3C2Q2_BAX-01      cg-----tgaaactgctattgccgattccc-ccgttactaccctgttggt
A0A3Q3CU65_BAX-01      ct-----tgtaactcagattccggatatta-tcagaacca--ttatcagt
A0A3Q2V329_BAX-01      ct-----tgtaactcagattccggatatta-tcagaacca--ttatcagt
A0A3Q2V329_BAX-02      ct-----tgtaactcagattccggatatta-tcagaacca--ttatcagt
                              *               *        *      *     *  * 

A0A3Q2UWG8_BOK-01      aaattcctgg-----ttcc----------------ctggctgaagcgacg
A0A3Q2VJY7_BAX-01      tgggtcctccaggtcatcagggagcaggtctacagctggcttgtggcaca
A0A3Q2VJY7_BAX-02      tgggtcctccaggtcatcagggagcaggtctacagctggcttgtggcaca
A0A3Q2VJY7_BAX-03      tgggtcctccaggtcatcagggagcaggtctacagctggcttgtggcaca
A0A3Q3C2Q2_BAX-01      cacttcatgttttgttttc------------------ataccagcaataa
A0A3Q3CU65_BAX-01      tggaccatagactatctccgggaacatgtgatcaactggatcagggagca
A0A3Q2V329_BAX-01      tggaccatagactatctccgggaacatgtgatcaactggatcagggagca
A0A3Q2V329_BAX-02      tggaccatagactatctccgggaacatgtgatcaactggatcagggagca
                            * *        *                                 

A0A3Q2UWG8_BOK-01      gggaggatgggtaa---------------gtttctgcctcagcaaaattt
A0A3Q2VJY7_BAX-01      agggggctgggagggggtgatccgtggtttctctcgatggaggaca----
A0A3Q2VJY7_BAX-02      agggggctgggagggggtgatccgtggtttctctcgatggaggaca----
A0A3Q2VJY7_BAX-03      agggggctgggagggggtgatccgtggtttctctcgatggaggaca----
A0A3Q3C2Q2_BAX-01      agct------gagg---------tttttgagtttcacgttagt-------
A0A3Q3CU65_BAX-01      aggtggctgggagg---------gtattcgctcctactttggcaca----
A0A3Q2V329_BAX-01      aggtggctgggagg---------gtattcgctcctactttggcaca----
A0A3Q2V329_BAX-02      aggtggctgggagg---------gtattcgctcctactttggcaca----
                        *        *                    *         *        

A0A3Q2UWG8_BOK-01      tgggcaaacatgaaatgcataaaaagttgacatttgagatacaacagcga
A0A3Q2VJY7_BAX-01      ---gcagccatggta----gcatcagtagtatt---------ggtggtag
A0A3Q2VJY7_BAX-02      ---gcagccatggta----gcatcagtagtatt---------ggtggtag
A0A3Q2VJY7_BAX-03      ---gcagccatggta----gcatcagtagtatt---------ggtggtag
A0A3Q3C2Q2_BAX-01      -------------------gtctgag--tcctg---------cgtttgga
A0A3Q3CU65_BAX-01      ---ccaa-catggcagacggtcgaagttttctt---------ggcaggag
A0A3Q2V329_BAX-01      ---ccaa-catggcagacggtcggagttttctt---------ggcaggag
A0A3Q2V329_BAX-02      ---ccaa-catggcagacggtcggagttttctt---------ggcaggag
                                               **                        

A0A3Q2UWG8_BOK-01      tttgcatttgctagttttgtgtgtgtgtgcaggggtggggtggggatttg
A0A3Q2VJY7_BAX-01      cctt--------tgtttactac-cgga-----aagtacgataa-------
A0A3Q2VJY7_BAX-02      cctt--------tgtttactac-cgga-----aagtacgataa-------
A0A3Q2VJY7_BAX-03      cctt--------tgtttactac-cgga-----aagtacgataa-------
A0A3Q3C2Q2_BAX-01      tcct--cctctccgcctgcc---cgcacacagagccctga----------
A0A3Q3CU65_BAX-01      tccttaccactgttcttgtcattcgca-----agatgtga----------
A0A3Q2V329_BAX-01      tccttaccactgttcttgtcattcgca-----agatgtga----------
A0A3Q2V329_BAX-02      tccttaccactgttcttgtcattcgca-----agatgtga----------
                                       *       *             *           

A0A3Q2UWG8_BOK-01      a
A0A3Q2VJY7_BAX-01      -
A0A3Q2VJY7_BAX-02      -
A0A3Q2VJY7_BAX-03      -
A0A3Q3C2Q2_BAX-01      -
A0A3Q3CU65_BAX-01      -
A0A3Q2V329_BAX-01      -
A0A3Q2V329_BAX-02      -
                        

© 1998-2023Legal notice