Dataset for CDS BCL-2-like of organism Cyprinodon variegatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q2FR43_BCL2L1-      atgtctcaga----------acaga--gaactggtccttttctacattaa
A0A3Q2GL87_BCL2L10      atgt----------------gcaga--gagccg------ttacatatca-
A0A3Q2C6K4_BCL2L1-      atgtcatacagta-------acaga--gaactggtagagttctatataag
A0A3Q2EDX8_MCL1-01      atgagttaccttattcttccacaaaatggagtcgtggacggacaaacgca
                        ***                  ** *  *               * *    

A0A3Q2FR43_BCL2L1-      gttcaaactg----tctcag--------------aggaactatccc----
A0A3Q2GL87_BCL2L10      ---------------ctggg--------------aggaa-----------
A0A3Q2C6K4_BCL2L1-      ctacaaactg----tctcag--------------acaaactgccca----
A0A3Q2EDX8_MCL1-01      ctacagcccggagattgcagcaccagaaataccaatgaactccccaatgg
                                           *              *  **           

A0A3Q2FR43_BCL2L1-      -gtcaaccacataatgctcaacgagccgcccaacggcaccggcgcccagg
A0A3Q2GL87_BCL2L10      ------------aatgtcctgtgggctgtggaaagagaccgtggct---g
A0A3Q2C6K4_BCL2L1-      -aactctctgctgag------------gtcggaggtcactggtg-----g
A0A3Q2EDX8_MCL1-01      gatctcttcaccgaaacttaatgaaacgtccgaaggatctgcaa-----g
                                     *             *    * *   * *        *

A0A3Q2FR43_BCL2L1-      gggcggagcaggacgacgagcgtacgccggagacgcac-----gctaacg
A0A3Q2GL87_BCL2L10      tcgcagaggattac-atgcgcctgcgctgctccagccc-----gct----
A0A3Q2C6K4_BCL2L1-      ccggaccgagggag-acaaggacgcctcgg-------cttccag-caatg
A0A3Q2EDX8_MCL1-01      tagcaacga--------atggatacgttggaaaaaacctttcagacaaca
                          *    *           *    *   *        *     *      

A0A3Q2FR43_BCL2L1-      ggacttttaacgggaccag------tccaggctccccgcggcgac-----
A0A3Q2GL87_BCL2L10      --------------cccag------ccccgccacctcccagtga------
A0A3Q2C6K4_BCL2L1-      gcccacttttcaacagcag------gcccagcccccccgggaagc-----
A0A3Q2EDX8_MCL1-01      gcgca---gacgacggcgggtctctgccgtgcaccccggagatgccaacg
                                        * *       **   * ** *   *         

A0A3Q2FR43_BCL2L1-      --------agcaggcgtccacagccgccatggaggcggtgaaggcggcgc
A0A3Q2GL87_BCL2L10      ---------------gcccgccgctgccat-gaggcgcctggcccaggac
A0A3Q2C6K4_BCL2L1-      --------ctcgggccccccatggaagcatagaggctgtaaaatccgctc
A0A3Q2EDX8_MCL1-01      gacagccaccccgccacaccgggcggccatgcgggggacgaa----gcgc
                                          *   *    ***   **           *  *

A0A3Q2FR43_BCL2L1-      tgagagacacggcctgcgagttcgagctgcgctacgcccgcgccttcaac
A0A3Q2GL87_BCL2L10      atggagacccagcac-caggctcg----tttccacaccctggcccagagc
A0A3Q2C6K4_BCL2L1-      tgaaggactcagcaaatgagtttgaacttctcttctctcaaagtttcagt
A0A3Q2EDX8_MCL1-01      tggacaacgacacgaaggagcttattagcagtttcctaagagactttacg
                              **    *      * *            *            *  

A0A3Q2FR43_BCL2L1-      gaccttcacagcacgctg-cacatcacgccggc-caccgcctaccaga--
A0A3Q2GL87_BCL2L10      ttcct---------gagg-cacagcgggacgga-cctctgctcc---a--
A0A3Q2C6K4_BCL2L1-      gacctctccatgcagcta-gacatcacccctga-cacggcctaccaca--
A0A3Q2EDX8_MCL1-01      ggacttcctaaacaacggcggaatcaaactaaagctctgtctaccatgaa
                           **                 * *         *     ** *      

A0A3Q2FR43_BCL2L1-      -------------------------------------gctt-cgagaacg
A0A3Q2GL87_BCL2L10      -------------------------------------gcct-caggaagg
A0A3Q2C6K4_BCL2L1-      -------------------------------------gctt-taaggccg
A0A3Q2EDX8_MCL1-01      aagggtggtggaggacgttttgtcgaaacacagatacgcttacaatggta
                                                             ** *         

A0A3Q2FR43_BCL2L1-      tgatgaacgag--gtgttcc---------------gggacgg---cgtc-
A0A3Q2GL87_BCL2L10      tgatggacgag--atggtgg---------------gggacggactcttt-
A0A3Q2C6K4_BCL2L1-      tgttggacgag--ttgttca---------------aggatgggatc----
A0A3Q2EDX8_MCL1-01      tgatgaataagctttgtttagatgaagtaccggacaacatgggatttgtg
                        ** ** *  **   ** *                    * **        

A0A3Q2FR43_BCL2L1-      ---------------------------------------aactggggccg
A0A3Q2GL87_BCL2L10      ---------------------------------------aactgggggag
A0A3Q2C6K4_BCL2L1-      ---------------------------------------aactggggccg
A0A3Q2EDX8_MCL1-01      agttcagtcgccacgagcctcttttcagacggaaccacgaattggggccg
                                                               ** *****  *

A0A3Q2FR43_BCL2L1-      catcgtgggcctgttcgccttcggcggagcgctg----------tgc-gt
A0A3Q2GL87_BCL2L10      ggtcgtatccctctttacctttgccggcgtgctggccagacagctgcagg
A0A3Q2C6K4_BCL2L1-      tgtggtggggctgtttgcctttggtggggttctgtgtgtgcact------
A0A3Q2EDX8_MCL1-01      gatagtgagcctggtggccttcggggctgtggtgtgtcagcacct---ga
                          * **    **  *  **** *  *  *   **                

A0A3Q2FR43_BCL2L1-      ggaatgcgtggagaa----ggagatgagt-cccctggtggggcgga----
A0A3Q2GL87_BCL2L10      agcaaacgggcaaaaacccggggctggat-cctgggaggcagcaggaact
A0A3Q2C6K4_BCL2L1-      -----gcgtgcagaa----gaatatgagt-gagttggtgtcccgca----
A0A3Q2EDX8_MCL1-01      aggagaaaggcagag----agaactgcgtggagctggtgagcca------
                                 * * *          **  *      *  *   *       

A0A3Q2FR43_BCL2L1-      -----------------------------tcgtggagtggatgaccgtct
A0A3Q2GL87_BCL2L10      gcaaacggagcccgtaagctgccgggcgctggcagagaccatcgccgatt
A0A3Q2C6K4_BCL2L1-      -----------------------------ttgcagactggatgaccattt
A0A3Q2EDX8_MCL1-01      ---------------------------------aga---gatctccacat
                                                          **    **  **   *

A0A3Q2FR43_BCL2L1-      acttggatgagcagatcgatccctggatccagagccaaggagg-------
A0A3Q2GL87_BCL2L10      atctggagacgcacaaaaaagactggctgcaggaaaataatgg-------
A0A3Q2C6K4_BCL2L1-      acctagatgagcagcttaacccttggatccacagccagggagg-------
A0A3Q2EDX8_MCL1-01      acct------gctgcaaaatcagagggac--tggctagtaaagaacaatt
                        *  *      **      *     **          *     *       

A0A3Q2FR43_BCL2L1-      -atgggaacgctttgctgaaatcttcggaggcgacgcagcggctgagag-
A0A3Q2GL87_BCL2L10      -atgggatgggtt--ctgtaa-ctacg-----cccgcaacgccagagaag
A0A3Q2C6K4_BCL2L1-      -atgggactgctttgctaagctgtacggccaagacgccgctgcagaggg-
A0A3Q2EDX8_MCL1-01      catggaatggatttgtggagtt-----------------cttcagagta-
                         **** *  * **                          *  * ***   

A0A3Q2FR43_BCL2L1-      -----cagaaggtctcaggagagcctgaaga----actggctgctgctgg
A0A3Q2GL87_BCL2L10      tcagccaggactcctc-------catgaagacggcgctggttgctgtt--
A0A3Q2C6K4_BCL2L1-      -----gcggagatctcacgagacattgaacaa-------atggctgct--
A0A3Q2EDX8_MCL1-01      -----gaagat-cctgaagcaacaatgaggaacactctcatggctttt--
                                 *   **          ***  *           ***  *  

A0A3Q2FR43_BCL2L1-      ggatgagcgtggccaccgccctcatagccggctccatcttcgcccacaaa
A0A3Q2GL87_BCL2L10      -----------gccggagtcggcatcgctggactcaccttcctcctggtg
A0A3Q2C6K4_BCL2L1-      -agttggtgcggctctgctcggcggagttctgctcactgtgcttgttgct
A0A3Q2EDX8_MCL1-01      --gttggagtggctggtattggggcaa-------cattggcctttctgat
                                   **                     **              

A0A3Q2FR43_BCL2L1-      cg---cctgtga
A0A3Q2GL87_BCL2L10      cg---ctag---
A0A3Q2C6K4_BCL2L1-      aagaaacgatga
A0A3Q2EDX8_MCL1-01      ca-----ggtga

© 1998-2021Legal notice