Dataset for CDS Unclassified of organism Pan paniscus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A2R9B9U7_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Pan paniscus (length=240 residues).
atggtgcgatctcggctcactgcaacctctgtctcccaggttcaggaaaatggctttgtaaagaagcttgagcctaaatc
tggctggatgacttttctagaagttacaggaaagatctgtgaaatgctcttctgtcctgaagcaatactgttgaccagaa
aggacactccatattgtgaaaccggcctaatttttctgactcttatgaaaacgattgccaacacatacttctacttttaa
© 1998-2020Legal notice