Dataset for CDS BOK of Organism Dicentrarchus labrax

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C4EG79_BOK-01      atggaggtcctgcgtaggtcctctgtgtttgctgcagaggtcctggatgt
A0A8C4I2Z8_BOK-01      atggatatgttgcgccgctcgtctgtgtttgcggctgag---------gt
                       *****  *  ****  * ** *********** ** ***         **

A0A8C4EG79_BOK-01      atttgaccggtcgttgactgagaaggagctggtgtcccagtctaaagcct
A0A8C4I2Z8_BOK-01      gttcgaccgctcgcccaccgacaaggagctggtgtcccaggccaaagcac
                        ** ***** ***   ** ** ****************** * *****  

A0A8C4EG79_BOK-01      tgtgcagagactacatactgtccagactcaaccagaatggactcggatgg
A0A8C4I2Z8_BOK-01      tgtgcagggactacattcactccaggctgaaccgtgccgggataggctgg
                       ******* ******** *  ***** ** ****     **  * ** ***

A0A8C4EG79_BOK-01      tccaaaactgaactcaacttctctccctcaaatgcagcgctggctgaggt
A0A8C4I2Z8_BOK-01      tctaagcctgaacacggactggctgcatcaggtgggacgctgggagagat
                       ** **  ****** *    *  ** * ***  **   ******  *** *

A0A8C4EG79_BOK-01      gtctttggtgcttctctgtcttggcgacgagctggagtgtatacagccca
A0A8C4I2Z8_BOK-01      atcgtcggttctgctgtggctgggtgatgagttggagtaccttcggccca
                        ** * *** ** ** ** ** ** ** *** ******   * * *****

A0A8C4EG79_BOK-01      gcttgtacaggaacgtggcgcggcagctcaacatttctgttgccatggag
A0A8C4I2Z8_BOK-01      acgtttaccgcaatgtagcgcgacagctcaacatcacagtggcgtcagag
                        * * *** * ** ** ***** ***********  * ** **    ***

A0A8C4EG79_BOK-01      agcatggtttcagatgccttcatcggcgtggcaacagagatcttctcaac
A0A8C4I2Z8_BOK-01      agcattgtgtccgacgccttcctggctgtggctgcagacattttctccac
                       ***** ** ** ** ****** * *  *****  **** ** ***** **

A0A8C4EG79_BOK-01      aggta---------------------taacgtggggtaaggtggtatcca
A0A8C4I2Z8_BOK-01      aggtaggtccacatcaaaatccggtgtgacatgggggaaggtggtttctt
                       *****                     * ** ***** ******** **  

A0A8C4EG79_BOK-01      tgtacgcagtcgccggagctctggcagtggattgtgttagacaaggacat
A0A8C4I2Z8_BOK-01      tgtacgccgtggcaggagccttggcagtggactgtgttcgccacggtcat
                       ******* ** ** *****  ********** ****** * ** ** ***

A0A8C4EG79_BOK-01      ccaaccactgttcatatcttagtggacagtttgggtcagtttgtccgcaa
A0A8C4I2Z8_BOK-01      ccagctatggtccataccattgtcgactgcatgggggagtttgtccgcaa
                       *** * *  ** **** * * ** *** *  ****  *************

A0A8C4EG79_BOK-01      gtttctggttcactggctgaagagacggggaggatgggcggagatcacaa
A0A8C4I2Z8_BOK-01      gagcctgacctcctggttgaaaaggagagggggctgggtggatgtaacaa
                       *   ***     **** **** **  * ** ** **** ***  * ****

A0A8C4EG79_BOK-01      agtgtgtggtgaagaaggatctcacccccgaacaccactggctatcctct
A0A8C4I2Z8_BOK-01      aatgcgtggtgaacacggatcccagtttccgctctcactggctggtgtct
                       * ** ******** * ***** **    *      ********    ***

A0A8C4EG79_BOK-01      accatggagtccctgaagtacttcctca---ccacgatgtacatctacat
A0A8C4I2Z8_BOK-01      gctgtctgtgcatttggacactatctgaaggccacggtgt---tatacct
                        *  *     *  *     ***  ** *   ***** ***   * *** *

A0A8C4EG79_BOK-01      catgaaagaaccgtga
A0A8C4I2Z8_BOK-01      cctccgggagaagtga
                       * *    **   ****

© 1998-2023Legal notice