Dataset for CDS BCL2A1 of organism Mus spicilegus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8C6GN16_BCL2A1-      atgagtgagtatgagttcacgtatatccactccctggctgagcactacct
A0A8C6H5H7_BCL2A1-      atgactgagtccgagctcatgcatatccactccctggctgagcactactt
                        **** *****  *** *** * ************************** *

A0A8C6GN16_BCL2A1-      tcagtatgtgctacaggtacccgcctttgagtcggctccaagccaagcat
A0A8C6H5H7_BCL2A1-      tcagtatgtcctacaggtacctgcctttgagtcggctccaagcaaagcat
                        ********* *********** ********************* ******

A0A8C6GN16_BCL2A1-      acagactgctgcaaagagttgctttctctgttcagaaggaagttggaaag
A0A8C6H5H7_BCL2A1-      gcagagtgctacaaagagttgctttctccgttcagaaggaagttgaaaag
                         **** **** ***************** **************** ****

A0A8C6GN16_BCL2A1-      aacctgaagtcatacttggatgactttcacgtggaatccatagatactgc
A0A8C6H5H7_BCL2A1-      aatctgaagtcatacttggatgactttcacgtggaatccatagataccgc
                        ** ******************************************** **

A0A8C6GN16_BCL2A1-      cagaataatattcaaccaagtgatgaaaaaagagtttgaagatggcatca
A0A8C6H5H7_BCL2A1-      cagaataatattcaaccaagtgatggaaaaagagtttgaagatggcatca
                        ************************* ************************

A0A8C6GN16_BCL2A1-      ttaattggggaaagattgtgactatatttacctttgggggtgttctcctc
A0A8C6H5H7_BCL2A1-      ttaactggggaaggattgtgactatatttgcctttgggggtgttctcctc
                        **** ******* **************** ********************

A0A8C6GN16_BCL2A1-      aaaaaacttccacaaga---------------------------------
A0A8C6H5H7_BCL2A1-      aaaaaacttccacaagagcagattgccctggatgtaggtgcttacaaaca

A0A8C6GN16_BCL2A1-      ---------ttttctggcagaattcataatgaataacacaggagaatgga
A0A8C6H5H7_BCL2A1-      agtttccagttttgtggcagaattcataatgaataacacaggagaatgga
                                 **** ************************************

A0A8C6GN16_BCL2A1-      tatggcaggatggagactgggtatct---ttcaaaaaatccagaggtttt
A0A8C6H5H7_BCL2A1-      tacggcggaatggaggttgggaagatggcttcataa-----agaagtttg
                        ** *** * ******  **** *  *   **** **     *** **** 

A0A8C6GN16_BCL2A1-      aaatttttttggattatcggtgtactatgtgccagtctgctttgtaaggc
A0A8C6H5H7_BCL2A1-      aacc---------------------------caaatctggct-----ggc
                        **                             * * ****  *     ***

A0A8C6GN16_BCL2A1-      tataatatctcacacagtaaattataagaaaaaaaaaaaaaaaaagaaga
A0A8C6H5H7_BCL2A1-      t-------------------------------------------------

A0A8C6GN16_BCL2A1-      cgacgtttagggagtctgagagtgctggcatccaaggcaccagcattgat
A0A8C6H5H7_BCL2A1-      -gacttttctgcag-------------------------------atgac
                         *** ***  * **                                *** 

A0A8C6GN16_BCL2A1-      gggctgcatctgttaagagccctcttgctgaaatatgggagaattaccca
A0A8C6H5H7_BCL2A1-      aggacagatctgggaaatgctctttctcc---------------------
                         **    *****  **  ** ** *  *                      

A0A8C6GN16_BCL2A1-      ggaaatgaggtag
A0A8C6H5H7_BCL2A1-      -----tcaagtaa
                             * * *** 

© 1998-2023Legal notice