Dataset for CDS BCL2L1 of organism Maylandia zebra

[Download (right click)] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.8) multiple sequence alignment


A0A3P9D632_BCL2L1-01      atgtctcaaaacagagaacttgtgcttttctacataaggtataaactctc
A0A3P9D632_BCL2L1-02      atgtctcaaaacagagaacttgtgcttttctacataaggtataaactctc
                          **************************************************

A0A3P9D632_BCL2L1-01      ccagagaaactatcctctcaaccacatagtactcaacgagccttcgaaca
A0A3P9D632_BCL2L1-02      ccagagaaactatcctctcaaccacatagtactcaacgagccttcgaaca
                          **************************************************

A0A3P9D632_BCL2L1-01      ggactgatgggggggcagcggggttggatgaggaacagcgaatagacaca
A0A3P9D632_BCL2L1-02      ggactgatgggggggcagcggggttggatgaggaacagcgaatagacaca
                          **************************************************

A0A3P9D632_BCL2L1-01      cacgccaatgggacttttaatggcacgagtcccgggaccccaccggcatc
A0A3P9D632_BCL2L1-02      cacgccaatgggacttttaatggcacgagtcccgggaccccaccggcatc
                          **************************************************

A0A3P9D632_BCL2L1-01      cccgcagcggcggcagcagcagccgccatcaacgacggacctcgacgcag
A0A3P9D632_BCL2L1-02      cccgcagcggcggcagcagcagccgccatcaacgacggacctcgacgcag
                          **************************************************

A0A3P9D632_BCL2L1-01      tgaaggaggcgctccgggacacggccaatgagttcgagctgcgatacgct
A0A3P9D632_BCL2L1-02      tgaaggaggcgctccgggacacggccaatgagttcgagctgcgatacgct
                          **************************************************

A0A3P9D632_BCL2L1-01      cgtgccttcagcgaccttcacagccagctgcacatcacgccggccacggc
A0A3P9D632_BCL2L1-02      cgtgccttcagcgaccttcacagccagctgcacatcacgccggccacggc
                          **************************************************

A0A3P9D632_BCL2L1-01      ctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggcgtta
A0A3P9D632_BCL2L1-02      ctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggcgtta
                          **************************************************

A0A3P9D632_BCL2L1-01      actggggccgcatcgtagggcttttcgcgttcggcggggcactgtgtgtc
A0A3P9D632_BCL2L1-02      actggggccgcatcgtagggcttttcgcgttcggcggggcactgtgtgtc
                          **************************************************

A0A3P9D632_BCL2L1-01      gagtgcgtcgagaaggagatgagccccttggtgggcaggatcgtagagtg
A0A3P9D632_BCL2L1-02      gagtgcgtcgagaaggagatgagccccttggtgggcaggatcgtagagtg
                          **************************************************

A0A3P9D632_BCL2L1-01      gatgacggtctacctagacaaccacattcagccctggatccagagccaag
A0A3P9D632_BCL2L1-02      gatgacggtctacctagacaaccacattcagccctggatccagagccaag
                          **************************************************

A0A3P9D632_BCL2L1-01      gaggatgggagcgcttcgctgaaatcttcgggcaggatgcggcggctgaa
A0A3P9D632_BCL2L1-02      gaggatgggagcgcttcgctgaaatcttcgggcaggatgcggcggctgaa
                          **************************************************

A0A3P9D632_BCL2L1-01      agccggaggtctcaggagagtttcaagaagtggctgctggtggggatgac
A0A3P9D632_BCL2L1-02      agccggaggtctcaggagagtttcaagaagtggctgctggtggggatgac
                          **************************************************

A0A3P9D632_BCL2L1-01      ggtggtgacaggcgttgtggcgggtgcgcttatcgcgcaaaaacgcctgt
A0A3P9D632_BCL2L1-02      ggtggtgacaggcgttgtggcgggtgcgcttatcgcgcaaaaacgcctgt
                          **************************************************

A0A3P9D632_BCL2L1-01      ga
A0A3P9D632_BCL2L1-02      ga
                          **

© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice