Dataset for CDS BCL2L1 of organism Junco hyemalis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C5JFI3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Junco hyemalis GN=BCL2L1 (length=1011 residues).
atgtacagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagaaaggatacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcaggggaggaggacgagatggacggggtcctcaacgggagcccctcct
ggcacgcagccaccagccacatagtgaacggagccaccgtgcaccagagcagcctcgaagtgcacgagatccgtcgagca
gccgacgtgaggcaggcgctgagagaggcaggggatgagttcgagctgaggtaccggcgggcgttcagcgacctcacctc
ccagctccacatcacccccagcacggcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatggagtgaact
ggggccgcatcgtggctttcttctccttcggaggagccctgtgcgtggagagcgttgttaaggagatgagggtattggtg
aaacgcatcgtgtcttggatgaccacgtacttgaccgaccacttagacccctggatccaggagaatggcggatgggagcg
ctttgtggacctctatgggaacgatgctgctgccgagatgaggaaaggccaggagaccttcaacaaatggctcctgacgg
gggcgacagtggctgaggccaatgcagcacttcagccaccagctcccagcgctggggagatccaggcagctggcgggggg
cgcaggctagaaggtgtcccagccctgcagggttctccaaataatttggaagagaataaacagacttatttttgcatgtg
tgagtgcgtgcgtgtgtgtagatgtgtcactaatataaaagttccccagccagagcaagggtcaggctccgtgcccccgt
ctctggcacacacaggcaccagggagaggcaggagcttccctgcagcatccctatcctgtccttgcttctccagtcagag
ctcatccctgaggcagggggaggaagaggaggaggcagaggccagaggtga
© 1998-2022Legal notice