Dataset for CDS BAK1 of Organism Bos mutus grunniens

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B9YH53_BAK1-01      atggcttccggacaaggcccaggtccccccgggcaggactgcgacgagcc
A0A8B9YH53_BAK1-02      atggcttccggacaaggcccaggtccccccgggcaggactgcgacgagcc
                        **************************************************

A0A8B9YH53_BAK1-01      tgacccctcctccacctcagaggagcaggtagcccgggacaccgaggagg
A0A8B9YH53_BAK1-02      tgacccctcctccacctcagaggagcaggtagcccgggacaccgaggagg
                        **************************************************

A0A8B9YH53_BAK1-01      tcttccgcagctacgtcttttaccgccatcagcaggaacaggaggccgag
A0A8B9YH53_BAK1-02      tcttccgcagctacgtcttttaccgccatcagcaggaacaggaggccgag
                        **************************************************

A0A8B9YH53_BAK1-01      ggggcggctgcgcctactgacccagagatggtcaccttgcacccagaacc
A0A8B9YH53_BAK1-02      ggggcggctgcgcctactgacccagagatggtcaccttgcacccagaacc
                        **************************************************

A0A8B9YH53_BAK1-01      tagcagcaccatggggcaggtgggccgccagctcgccgtcatcggggacg
A0A8B9YH53_BAK1-02      tagcagcaccatggggcaggtgggccgccagctcgccgtcatcggggacg
                        **************************************************

A0A8B9YH53_BAK1-01      acatcaaccggcgctatgatgcggagttccaggccatgctgcagcacctg
A0A8B9YH53_BAK1-02      acatcaaccggcgctatgatgcggagttccaggccatgctgcagcacctg
                        **************************************************

A0A8B9YH53_BAK1-01      cagccaacagcagacaacgcctatgagtacttcaccaagatcgcgtccag
A0A8B9YH53_BAK1-02      cagccaacagcagacaacgcctatgagtacttcaccaagatcgcgtc---
                        ***********************************************   

A0A8B9YH53_BAK1-01      gccagcagcagcacccacagcctgtttgagagcggtatcaactggggccg
A0A8B9YH53_BAK1-02      -----------------cagcctgtttgagagcggtatcaactggggccg
                                         *********************************

A0A8B9YH53_BAK1-01      cgtggtggctctgctgggctttggctaccgcctggccctccacgtctacc
A0A8B9YH53_BAK1-02      cgtggtggctctgctgggctttggctaccgcctggccctccacgtctacc
                        **************************************************

A0A8B9YH53_BAK1-01      agcgtggcctga--------------------------------------
A0A8B9YH53_BAK1-02      agcgtggcctgaccggcttcctgggccaggtgacccgcttcgtggccgac
                        ************                                      

A0A8B9YH53_BAK1-01      --------------------------------------------------
A0A8B9YH53_BAK1-02      ttcatgctgcgtcgctccatcgcccggtggatcgcgcagaggggtggctg
                                                                          

A0A8B9YH53_BAK1-01      --------------------------------------------------
A0A8B9YH53_BAK1-02      ggtggcagccctggacttggggaacggccccatcaagagcgtagccatcg
                                                                          

A0A8B9YH53_BAK1-01      --------------------------------------------------
A0A8B9YH53_BAK1-02      ttctggctgtggttttgttgggccagtttgtggtacgaagattcttcaag
                                                                          

A0A8B9YH53_BAK1-01      ------
A0A8B9YH53_BAK1-02      tcatga
                              

© 1998-2023Legal notice