Dataset for CDS Unclassified of organism Hucho hucho

[Download (right click)]

6 sequence(s)

>gnl|bcl2dbcds|A0A4W5L145_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Hucho hucho (length=498 residues).
atgaagatatcacatcaggaaacctgtgatgctctggacacagacaccaggcaacttatgacatgtgtcctaggacaata
tacgggacttctgaaacgtgggtggaacgaaagcaaagctctgtcaacaatgagtcgttggtcaattactggagaaacac
agatacacatacaatggtttgtcagtacactagcccatatcatctttcgagacgggaccgtcaactggggccgcgttgcc
agcctgacatcatttggggctgcggtgtgtcagtacttgaaagacgaggggagagacaactgtgtggagttggtgggaga
ggagatatcagcatacctggtcactcaccacaaggactggctagtcaaacacaactcctggaacggtttcgtggagttct
tttcagtagcagaaacggagtccagatcgaggaacatcatcgcgacccttgtcggattggctggtattggggcagcaatg
accttgttagttatgtga
>gnl|bcl2dbcds|A0A4W5L7M3_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Hucho hucho (length=579 residues).
atgaataacacccatggagttgcatgtgtatataagtgccaacgctgtaaagggatcctgagtagttgtgagcttgaaac
ctgtgatgctctggacacagacaccaggcaacttattaaatgtgtcctaggacaatatacgggacttctgaaacgtgggt
ggaacgaaagcaaagctctgtcaacaatgagtagagtcgttggtcaattactggagaaacacagatacacatacaatggt
aggtattgtgggatgatgtttgtcagtacactagcccatatcatctttcgagacgggaccgtcaactggggccacgttgc
cagcctgacatcatttggggctgcggtgtgtcagtacttgaaagacgaggggagagacaactgtgtggagttggtgggag
aggagatatcagcatacctggtcactcaccacaaggactggctagtcaaacacaactcctggaacggtttcgtggagttc
ttttcagtagcagaaccggagtccagatcgaggaacatcatcgcgacccttgtcggattggctggtattggggcagcaat
gaccttgttagttatgtga
>gnl|bcl2dbcds|A0A4W5L9W4_uncBCL2L10-01 Putative BCL2-like 10 gene OS=[Eukaryota] Hucho hucho (length=591 residues).
atgtcatgcgggctgtggaaagaaaccctggctatagcagaggactacctgtctgtctgcagtattatccctgccagtgg
gtcccggaaagccccgcccggtcctcctcccagcgactcggctgcagccatgcggcgccaggcccgggacatggaggcca
agcaccgggcccgcttccacgccctagcacacagcttcctgtgccaatgcgggccggacccctgcgccagtctgaggagg
gtgatggaggagctagtgggagacggacagatgaactgggggagggtggtctctctgttcactttcactggtgtgctggt
tagagagctacagggggaggacacggaccaggcgctggggaatggcatggggctgggggggaaggagagctgcagggcgc
tggctgagaccatagcagactacctaggagaggagaagagtgactggatgctggagaacaaaggctgggagggcttctgt
aagttcttccacacagcaagagaggtgaaccaggactcgtccatgaagactgccctgtttgctgctgctggcgtgggcat
cgcagggttaaccttcctcctggtccgctaa
>gnl|bcl2dbcds|A0A4W5NU21_uncBCL2-02 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Hucho hucho (length=687 residues).
atggcaaacgacgacaaccgctttatagtggaaaagtacatttgtcacaaactcttgaaaatgggatatgcgtgggattt
cgagaatgccgaggatgaggaagatgctgatattaatgtgtcgatgcctggtttggcacggcggtgccacggggccaata
acgccagaccgggcagcgtcccccatgtttccaaacggctctcccaaccggacccgcatgcagctattcacagagttttg
cgtgaggccggggacgaactcgaacgactgtaccagaccgactttgcggagatgtcacaccaattgtatctgacgtcttc
catggcagagaggagattcaaagaggtgatagacgagctgttcagggacggggttaactggggacgaattaccgccttct
tcgagttcgggggcacaatatgtgtggaatgcgtgaacaaggaaatgacgtcgcaggttgaccacatcgccgggtggatg
acggagtatctaaatggaccgctgcacagctggattcaagagaacgggggatgggaaggagcgtctaacattccccttga
gtctcgtctgcccctgaaggtggcaggttgtgccacatatcaaagggaagcacagagaggagagagggacctccaggatt
acagaaccacagactacagccagcctgtatgtatatttaacatgtaa
>gnl|bcl2dbcds|A0A4W5NU21_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Hucho hucho (length=768 residues).
atggcaaacgacgacaaccgctttatagtggaaaagtacatttgtcacaaactcttgaaaatgggatatgcgtgggattt
cgagaatgccgaggatgaggaagatgctgatattaatgtgtcgatgcctggtttggcacggcggtgccacggggccaata
acgccagaccgggcagcgtcccccatgtttccaaacggctctcccaaccggacccgcatgcagctattcacagagttttg
cgtgaggccggggacgaactcgaacgactgtaccagaccgactttgcggagatgtcacaccaattgtatctgacgtcttc
catggcagagaggagattcaaagaggtgatagacgagctgttcagggacggggttaactggggacgaattaccgccttct
tcgagttcgggggcacaatatgtgtggaatgcgtgaacaaggaaatgacgtcgcaggttgaccacatcgccgggtggatg
acggagtatctaaatggaccgctgcacagctggattcaagagaacgggggatgggaggcctttgttgagctctatgacag
acagagggactccgtgttctgttcgtggccgtccatcaagactgtctttggcctggctgcactgggggccgcaagcctta
ccatcggagcttaccttacacagaaaactcaaggtctcacccacccaagccaagccaccgctgaaaggggactgaaccaa
cccgccaaatctcccagaacatgtcctccagctgctgctgggctctga
>gnl|bcl2dbcds|A0A4W5P0G2_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Hucho hucho (length=609 residues).
atggcaaacgataatccttataacagtcgcgttattgttgaaaaatacatccatcacaaactgttgaagaagggatttga
ttgggaatttaatacagaaaacgattccccaaataatggcattggggagatcccgcaaccggaccgacatgcccggctcc
aaagggtgctgcgcgaggcgggggacgagattgaaagaatgtatcagcgggactttgcagagatgtcggggcggttgcat
tttacgcccagtacggcacagagaatgtttactgctgtaatagaggagctcttcagcgacggggtaaactggggtcggat
tgtggctttctttgagtttggagggacaatgtgcgtggagagcgtcaaccgggagatgacgtcccaggtagacaacattg
cccattggatgacggagtacctgaacggacccctgcagaactggatccaggagaatggtgactgggtatgtctgttaata
aatcattccacatttcctagccctacacggacaatgattgatttgttgtctgtttctgcggtccatatatctcctggcca
atatttcagtcaatctaaggaaaccctaccctacccttattctgactga
© 1998-2020Legal notice