Dataset for CDS BCL-2-like of organism Pan paniscus

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2R8ZJX9_BCL2A1-      atgacagact--------gtgaatttggatatatttacaggctggctcag
A0A2R8ZJX9_BCL2A1-      atgacagact--------gtgaatttggatatatttacaggctggctcag
A0A2R9BCD9_BCL2L10      atggttgaccagtggcgtgagcgcactaccatggccga--cccgctgcgg
A0A2R9APW6_BCL2-01      atggcgcacg--ctgggagaacagggtacgataaccgggagatagtgatg
A0A2R9BPJ5_MCL1-03      atgtttggcc--tcaaaagaa----acgcggtaatcgg------------
A0A2R9BPJ5_MCL1-01      atgtttggcc--tcaaaagaa----acgcggtaatcgg------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      atgtc--------------------tcagagcaaccgggagctggtggtt
A0A2R9A2Q3_BCL2L2-      atggcgaccc-----cagcctcagccccagacacacgggctctggtggca
A0A2R9A2Q3_BCL2L2-      atggcgaccc-----cagcctcagccccagacacacgggctctggtggca
                                                                          

A0A2R8ZJX9_BCL2A1-      gactatctgcagtac-----gtcctacagataccacaacc----------
A0A2R8ZJX9_BCL2A1-      gactatctgcagtac-----gtcctacagataccacaacc----------
A0A2R9BCD9_BCL2L10      gagcgcaccgag------cggttgctggccgactac--ctgggg------
A0A2R9APW6_BCL2-01      aagtacatccattataagctgtcgcagaggggctacgagtggga------
A0A2R9BPJ5_MCL1-03      ------actcaacct---ctactgtgggggggc--cggcttggg------
A0A2R9BPJ5_MCL1-01      ------actcaacct---ctactgtgggggggc--cggcttggg------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
A0A2R9A2Q3_BCL2L2-      gactttgtaggttataagctgaggcagaagggttatgtc-----------
A0A2R9A2Q3_BCL2L2-      gactttgtaggttataagctgaggcagaagggttatgtc-----------
                                                                          

A0A2R8ZJX9_BCL2A1-      --------tggatcaggtccaagccaaacgtccaga--------------
A0A2R8ZJX9_BCL2A1-      --------tggatcaggtccaagccaaacgtccaga--------------
A0A2R9BCD9_BCL2L10      ------tactgcgcccgggaacccggcacccccgag--------------
A0A2R9APW6_BCL2-01      ------tgcgggagatgtgggcgccgcgcccctcag--------------
A0A2R9BPJ5_MCL1-03      ------ggccggcagcggcggcgccacccctccgggagggcgactttt--
A0A2R9BPJ5_MCL1-01      ------ggccggcagcggcggcgccacccctccgggagggcgacttttgg
A0A2R8Z9D7_BCL2L1-      -----atgtggaagagaacaggactgaggccccagaagggactgaatcgg
A0A2R8Z9D7_BCL2L1-      tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcgg
A0A2R9A2Q3_BCL2L2-      ------tgtgga----------gct--ggccccggggagggccca---gc
A0A2R9A2Q3_BCL2L2-      ------tgtgga----------gct--ggccccggggagggccca---gc
                                  *            *       *                  

A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      ctacggagaaggaggcctcggcccggcgagagatagggggaggggaggcc
A0A2R8Z9D7_BCL2L1-      agatgga-------------------------------------------
A0A2R8Z9D7_BCL2L1-      agatgga-------------------------------------------
A0A2R9A2Q3_BCL2L2-      agct----------------------------------------------
A0A2R9A2Q3_BCL2L2-      agct----------------------------------------------
                                                                          

A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      ggcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcac
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
                                                                          

A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      gccagactcccggagggtcgcgcggccgccgcccattggcgccgaggtcc
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
                                                                          

A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      ccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccgc
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
                                                                          

A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      cgcgcggcgccgcttgaggagatggaagccccggccgccgacgccatcat
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
                                                                          

A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      gtcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagc
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
                                                                          

A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      ggccggctgtcctgcctctgctggagttggtcggggaatctggtaataac
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
                                                                          

A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      accagtacggacgggtcactaccctcgacgccgccgccagcagaggagga
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
                                                                          

A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      ggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttc
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
                                                                          

A0A2R8ZJX9_BCL2A1-      ---------------gtgcta-----------------caaaatgttgca
A0A2R8ZJX9_BCL2A1-      ---------------gtgcta-----------------caaaatgttgca
A0A2R9BCD9_BCL2L10      ------------ccgacgccg-----------------tccacgcccg-a
A0A2R9APW6_BCL2-01      -----------cccggtgcca-----------------------cctgtg
A0A2R9BPJ5_MCL1-03      -------ggccaccggcgccaaggacacaaagccaatgggcaggtctg-g
A0A2R9BPJ5_MCL1-01      gggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctg-g
A0A2R8Z9D7_BCL2L1-      -------gacccccagtgcca-----------tcaatggcaacccatcct
A0A2R8Z9D7_BCL2L1-      -------gacccccagtgcca-----------tcaatggcaacccatcct
A0A2R9A2Q3_BCL2L2-      -------gacccgctgcac--------------------caagccatgcg
A0A2R9A2Q3_BCL2L2-      -------gacccgctgcac--------------------caagccatgcg
                                          *                               

A0A2R8ZJX9_BCL2A1-      ttct----------------------------------------------
A0A2R8ZJX9_BCL2A1-      ttct----------------------------------------------
A0A2R9BCD9_BCL2L10      ggcc----------------------------------------------
A0A2R9APW6_BCL2-01      gtcc----------------------------------------------
A0A2R9BPJ5_MCL1-03      ggcc----------------------------------------------
A0A2R9BPJ5_MCL1-01      ggcc----------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      ggcacctggcggacagccccgcggtgaatggagccactggccacagcagc
A0A2R9A2Q3_BCL2L2-      ggca----------------------------------------------
A0A2R9A2Q3_BCL2L2-      ggca----------------------------------------------
                                                                          

A0A2R8ZJX9_BCL2A1-      -------------------------------------------cagtcca
A0A2R8ZJX9_BCL2A1-      -------------------------------------------cagtcca
A0A2R9BCD9_BCL2L10      ------------------------gcc------------------gtgct
A0A2R9APW6_BCL2-01      ------------------------acc----------------tgaccct
A0A2R9BPJ5_MCL1-03      ------------------------accagcaggaaggcgctggagacctt
A0A2R9BPJ5_MCL1-01      ------------------------accagcaggaaggcgctggagacctt
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      agtttggatgcccgggaggtgatccccatggcagcagtaaagcaagcgct
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
                                                                          

A0A2R8ZJX9_BCL2A1-      aaaagaagtggaaaagaatctgaagt------------------------
A0A2R8ZJX9_BCL2A1-      aaaagaagtggaaaagaatctgaagt------------------------
A0A2R9BCD9_BCL2L10      gcgctccgcggccgccaggttacggcagatccaccggtccttcttctccg
A0A2R9APW6_BCL2-01      ccgccaggccggcgacgacttctcccgccgctaccgccgcgacttcgccg
A0A2R9BPJ5_MCL1-03      acgacgggttggggatggcgtgcagcgcaaccatgagacggccttccaag
A0A2R9BPJ5_MCL1-01      acgacgggttggggatggcgtgcagcgcaaccatgagacggccttccaag
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      gagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtg
A0A2R9A2Q3_BCL2L2-      -------gctggagatgagttcgagacccgcttccggcgcaccttctctg
A0A2R9A2Q3_BCL2L2-      -------gctggagatgagttcgagacccgcttccggcgcaccttctctg
                                                                          

A0A2R8ZJX9_BCL2A1-      -catgcttggacaatgttaatgttgtgtctgtagacactgccagaacact
A0A2R8ZJX9_BCL2A1-      -catgcttggacaatgttaatgttgtgtctgtagacactgccagaacact
A0A2R9BCD9_BCL2L10      -cctacctcggctac-------------------------cccgggaacc
A0A2R9APW6_BCL2-01      agatgtccagccagctgca----cctgacgcccttcaccgcgcggggacg
A0A2R9BPJ5_MCL1-03      gcatgcttcggaaactgga----catca----------aaaacgaagacg
A0A2R9BPJ5_MCL1-01      gcatgcttcggaaactgga----catca----------aaaacgaagacg
A0A2R8Z9D7_BCL2L1-      ---------------------------------gggacagcatatcagag
A0A2R8Z9D7_BCL2L1-      acctgacatcccagctcca----catcaccccagggacagcatatcagag
A0A2R9A2Q3_BCL2L2-      atctggcggctcagctgca----tgtgaccccaggctcagcccaacaacg
A0A2R9A2Q3_BCL2L2-      atctggcggctcagctgca----tgtgaccccaggctcagcccaacaacg
                                                                          

A0A2R8ZJX9_BCL2A1-      ----------attcaaccaagtgatggaaaaggagtttgaagatgg---c
A0A2R8ZJX9_BCL2A1-      ----------attcaaccaagtgatggaaaaggagtttgaagatgg---c
A0A2R9BCD9_BCL2L10      gcttcgagctggtggcgctgatggcggattccgtgctctccgacagcccc
A0A2R9APW6_BCL2-01      ---------ctttgccacg-gtggtggaggagctcttcagggacgg---g
A0A2R9BPJ5_MCL1-03      atgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacgg---c
A0A2R9BPJ5_MCL1-01      atgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacgg---c
A0A2R8Z9D7_BCL2L1-      ----------ctttgaacaggtagtgaatgaactcttccgggatgg----
A0A2R8Z9D7_BCL2L1-      ----------ctttgaacaggtagtgaatgaactcttccgggatgg----
A0A2R9A2Q3_BCL2L2-      ----------cttcacccaggtctccgatgaactttttcaaggggg----
A0A2R9A2Q3_BCL2L2-      ----------cttcacccaggtctccgatgaactttttcaaggggg----
                                    *    *   *              *    *   *    

A0A2R8ZJX9_BCL2A1-      atcattaactggggaagaattgtaaccatatttgcatttgaaggtattct
A0A2R8ZJX9_BCL2A1-      atcattaactggggaagaattgtaaccatatttgcatttgaaggtattct
A0A2R9BCD9_BCL2L10      ggccccacctggggcagagtggtgacgctcgtgaccttcgcagggacgct
A0A2R9APW6_BCL2-01      gt---gaactgggggaggattgtggccttctttgagttc-----gg----
A0A2R9BPJ5_MCL1-03      gtaacaaactggggcaggattgtgactctcatttctttt-----ggtgcc
A0A2R9BPJ5_MCL1-01      gtaacaaactggggcaggattgtgactctcatttctttt-----ggtgcc
A0A2R8Z9D7_BCL2L1-      --ggtaaactggggtcgcattgtggcctttttctccttc-----gg----
A0A2R8Z9D7_BCL2L1-      --ggtaaactggggtcgcattgtggcctttttctccttc-----gg----
A0A2R9A2Q3_BCL2L2-      --ccccaactggggccgccttgtagccttctttgtcttt-----gg----
A0A2R9A2Q3_BCL2L2-      --ccccaactggggccgccttgtagccttctttgtcttt-----gg----
                              * ******  *  * **  *  *  *    **            

A0A2R8ZJX9_BCL2A1-      catcaagaaacttcta--------cgacagcagattgccccggatgtgga
A0A2R8ZJX9_BCL2A1-      catcaagaaacttcta--------cgacagcagattgccccggatgtgga
A0A2R9BCD9_BCL2L10      gctggagagagggccgctggtgaccacccggtggaaga----agtggggc
A0A2R9APW6_BCL2-01      --tggggtcatgtgtg-tggagagcgtcaaccgggaga----tgtcg--c
A0A2R9BPJ5_MCL1-03      tttgtggctaaacact-tgaagaccataaaccaagaaagctgcatcgaac
A0A2R9BPJ5_MCL1-01      tttgtggctaaacact-tgaagaccataaaccaagaaagctgcatcgaac
A0A2R8Z9D7_BCL2L1-      --cggggcactgtgcg-tggaaagcgtagacaaggaga------tgcagg
A0A2R8Z9D7_BCL2L1-      --cggggcactgtgcg-tggaaagcgtagacaaggaga------tgcagg
A0A2R9A2Q3_BCL2L2-      --ggctgcactgtgtg-ctgagagtgtcaacaaggaga------tggaac
A0A2R9A2Q3_BCL2L2-      --ggctgcactgtgtg-ctgagagtgtcaacaaggaga------tggaac
                              *                                     *     

A0A2R8ZJX9_BCL2A1-      tacttat------------------aaggagatttcat------------
A0A2R8ZJX9_BCL2A1-      tacttat------------------aaggagatttcat------------
A0A2R9BCD9_BCL2L10      ttccagccgcggctaaaggagcaggagggcgacgtcgc-----------c
A0A2R9APW6_BCL2-01      ccctggt-------------------ggacaacatcgc---------cct
A0A2R9BPJ5_MCL1-03      cattagc-------------------agaaagtatcacagacgttctcgt
A0A2R9BPJ5_MCL1-01      cattagc-------------------agaaagtatcacagacgttctcgt
A0A2R8Z9D7_BCL2L1-      tattggt-------------------gagtcggatcgc------------
A0A2R8Z9D7_BCL2L1-      tattggt-------------------gagtcggatcgc------------
A0A2R9A2Q3_BCL2L2-      cactggt-------------------gggacaagtgca------------
A0A2R9A2Q3_BCL2L2-      cactggt-------------------gggacaagtgca------------
                                                          *               

A0A2R8ZJX9_BCL2A1-      ----------attttgttgcggagttcataatg------------aataa
A0A2R8ZJX9_BCL2A1-      ----------attttgttgcggagttcataatg------------aataa
A0A2R9BCD9_BCL2L10      cgggactgccagcgcctggtggccttgctgagctcgcggctcgtggggca
A0A2R9APW6_BCL2-01      gtggat-------gactga----gtacctgaacc------------ggca
A0A2R9BPJ5_MCL1-03      aaggacaaaacgggactgg----ctagttaaac-----------------
A0A2R9BPJ5_MCL1-01      aaggacaaaacgggactgg----ctagttaaac-----------------
A0A2R8Z9D7_BCL2L1-      --------agcttggatggccacttacctgaat------------gacca
A0A2R8Z9D7_BCL2L1-      --------agcttggatggccacttacctgaat------------gacca
A0A2R9A2Q3_BCL2L2-      --------ggagtggatggtggcctacctggag------------acgcg
A0A2R9A2Q3_BCL2L2-      --------ggagtggatggtggcctacctggag------------acgcg
                                        *       *   *                     

A0A2R8ZJX9_BCL2A1-      cacaggagaatggataagacaaaacggaggctggggg-------------
A0A2R8ZJX9_BCL2A1-      cacaggagaatggataagacaaaacggaggct-ggga-------------
A0A2R9BCD9_BCL2L10      gcaccgcgcctggctgcaggctcagggcggctgggat------ggctttt
A0A2R9APW6_BCL2-01      cctgcacacctggatccaggataacggaggctgggat------gcctttg
A0A2R9BPJ5_MCL1-03      -----------------------aaagaggctgggat------gggtttg
A0A2R9BPJ5_MCL1-01      -----------------------aaagaggctgggat------gggtttg
A0A2R8Z9D7_BCL2L1-      cctagagccttggatccaggagaacggcggctgggat------acttttg
A0A2R8Z9D7_BCL2L1-      cctagagccttggatccaggagaacggcggctgggat------acttttg
A0A2R9A2Q3_BCL2L2-      gctggctgactggatccacagcagtgggggctgggagctggaagctatca
A0A2R9A2Q3_BCL2L2-      gctggctgactggatccacagcagtgggggctgggcg------gagttca
                                                  * **** **               

A0A2R8ZJX9_BCL2A1-      -------------------------------------------aaatggc
A0A2R8ZJX9_BCL2A1-      -------------------------------------------aaatggc
A0A2R9BCD9_BCL2L10      gtcacttcttc----------------------------------aggac
A0A2R9APW6_BCL2-01      tggaactgtac-----------------------------------ggcc
A0A2R9BPJ5_MCL1-03      tggagttcttc---------------------------catgtagaggac
A0A2R9BPJ5_MCL1-01      tggagttcttc---------------------------catgtagaggac
A0A2R8Z9D7_BCL2L1-      tggaactctatgggaacaatgc------agcagccgagagccgaaagggc
A0A2R8Z9D7_BCL2L1-      tggaactctatgggaacaatgc------agcagccgagagccgaaagggc
A0A2R9A2Q3_BCL2L2-      aagctcgagtcagggagatgga---ggaagaagctgagaagctaaaggag
A0A2R9A2Q3_BCL2L2-      cagctctatacggggacggggccctggaggaggcgcggcgtctgcgggag
                                                                       *  

A0A2R8ZJX9_BCL2A1-      ---------acaatcacacgcctatgctggtagagtcagtggcccacaag
A0A2R8ZJX9_BCL2A1-      tttgtaaagaagtttgaacataaat-ctggctggatgacttttctagaag
A0A2R9BCD9_BCL2L10      ccc---------------------ctttccgctggct-ttttggagaaaa
A0A2R9APW6_BCL2-01      ccagcatgcggcctctg---tttgatttctcctggctgtctctgaagact
A0A2R9BPJ5_MCL1-03      ctagaaggtggcatcaggaatgtg----ctgctggct---tttgcaggtg
A0A2R9BPJ5_MCL1-01      ctagaaggtggcatcaggaatgtg----ctgctggct---tttgcaggtg
A0A2R8Z9D7_BCL2L1-      c--------------aggaacgcttcaaccgctggtt-cct-----gacg
A0A2R8Z9D7_BCL2L1-      c--------------aggaacgcttcaaccgctggtt-cct-----gacg
A0A2R9A2Q3_BCL2L2-      ctacagaacgaggtagagaagcagatgaatatgagtc-caccaccaggca
A0A2R9A2Q3_BCL2L2-      ---------------gggaactgggcatcagtgag-----------gaca
                                                                          

A0A2R8ZJX9_BCL2A1-      aagaggaa-----------------------------aatggctt-----
A0A2R8ZJX9_BCL2A1-      ttacagga-----------------------------aagatctg-----
A0A2R9BCD9_BCL2L10      cagctggt-----------------------------ccaggcttttctg
A0A2R9APW6_BCL2-01      ctgctcag-----------------------------tttggc-------
A0A2R9BPJ5_MCL1-03      ttgctgga-----------------------------gtagga-------
A0A2R9BPJ5_MCL1-01      ttgctgga-----------------------------gtagga-------
A0A2R8Z9D7_BCL2L1-      ggcatgac-----------------------------tgtggccggcg--
A0A2R8Z9D7_BCL2L1-      ggcatgac-----------------------------tgtggccggcg--
A0A2R9A2Q3_BCL2L2-      atgctggcccagtgatcatgtccattgaggagaagatggaggctgatgcc
A0A2R9A2Q3_BCL2L2-      gtgctgac-----------------------------gggggccg-----
                                                                          

A0A2R8ZJX9_BCL2A1-      --------------tg--------taa-----------------------
A0A2R8ZJX9_BCL2A1-      --------------tg--------aaatgctatctctcctgaagca----
A0A2R9BCD9_BCL2L10      tcatgc--------ttgt------taacaacagccttcatttatc-----
A0A2R9APW6_BCL2-01      ----cc--------tggtgggagcttgcatcaccctgggtgccta-----
A0A2R9BPJ5_MCL1-03      ----gc--------tggt------ttg-------------gcata-----
A0A2R9BPJ5_MCL1-01      ----gc--------tggt------ttg-------------gcata-----
A0A2R8Z9D7_BCL2L1-      --------------tgg-------ttctgctgggctcact----------
A0A2R8Z9D7_BCL2L1-      --------------tgg-------ttctgctgggctcact----------
A0A2R9A2Q3_BCL2L2-      cgttccatctatgttgg-------caatgtggactatggtgcaacagcag
A0A2R9A2Q3_BCL2L2-      --------------tgg-------cactgggggccctggt----------
                                      *                                   

A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      aagagctggaagctcactttcatggctgtggttcagtcaaccgtgttacc
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
                                                                          

A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      atactctgtgacaaatttagtggccatcccaaagggtttgcgtatataga
A0A2R9A2Q3_BCL2L2-      ------------aactgtaggggcctt-----------------------
                                                                          

A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      gttctcagacaaagagtcagtgaggacttccttggccttagatgagtccc
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
                                                                          

A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      tatttagaggaaggcaaatcaaggtgatcccaaaacgaaccaacagacca
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
                                                                          

A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      ggcatcagcacaacagaccggggttttccacgagcccgctaccgcgcccg
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
                                                                          

A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R9BCD9_BCL2L10      ------------------------------------------tctgg---
A0A2R9APW6_BCL2-01      ------------------------------------------tctgggcc
A0A2R9BPJ5_MCL1-03      ------------------------------------------tcta----
A0A2R9BPJ5_MCL1-01      ------------------------------------------tcta----
A0A2R8Z9D7_BCL2L1-      ------------------------------------------cttcagtc
A0A2R8Z9D7_BCL2L1-      ------------------------------------------cttcagtc
A0A2R9A2Q3_BCL2L2-      gaccaccaactacaacagttcccgctctcgattctacagtggttttaaca
A0A2R9A2Q3_BCL2L2-      ------------------------------------------ttttgcta
                                                                          

A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R8ZJX9_BCL2A1-      --------------------------------------------------
A0A2R9BCD9_BCL2L10      acacg---------------------------------------------
A0A2R9APW6_BCL2-01      acaag---------------------------------------------
A0A2R9BPJ5_MCL1-03      ataag---------------------------------------------
A0A2R9BPJ5_MCL1-01      ataag---------------------------------------------
A0A2R8Z9D7_BCL2L1-      ggaaa---------------------------------------------
A0A2R8Z9D7_BCL2L1-      ggaaa---------------------------------------------
A0A2R9A2Q3_BCL2L2-      gcaggccccggggtcgcgtctacaggggccgggctagagcgacatcatgg
A0A2R9A2Q3_BCL2L2-      gcaag---------------------------------------------
                                                                          

A0A2R8ZJX9_BCL2A1-      ---------------
A0A2R8ZJX9_BCL2A1-      -----atactgttga
A0A2R9BCD9_BCL2L10      -----attattatga
A0A2R9APW6_BCL2-01      -----tga-------
A0A2R9BPJ5_MCL1-03      -----atag------
A0A2R9BPJ5_MCL1-01      -----atag------
A0A2R8Z9D7_BCL2L1-      ------------tga
A0A2R8Z9D7_BCL2L1-      ------------tga
A0A2R9A2Q3_BCL2L2-      tattccccttactaa
A0A2R9A2Q3_BCL2L2-      ------------tga
                                       

© 1998-2020Legal notice