Dataset for CDS BCL-2-like of organism Pan paniscus

[Download (right click)] [Edit] [Sequences] [Repertoires]

13 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2R8ZJ66_BCL2A1-      atgacagact--------gtgaatttggatatatttacaggctggctcag
A0A2R8ZJ66_BCL2A1-      atgacagact--------gtgaatttggatatatttacaggctggctcag
A0A2R8ZJ66_BCL2A1-      atgacagact--------gtgaatttggatatatttacaggctggctcag
A0A2R9BCD9_BCL2L10      atggttgaccagtggcgtgagcgcactaccatggccga------------
A0A2R9APW6_BCL2-01      atggcgcacg--ctgggagaacagggtacgataaccgggagatagtgatg
A0A2R9BPJ5_MCL1-02      atgtttggcc--tcaaaagaa----acgcggtaatcgg------------
A0A2R9BPJ5_MCL1-01      atgtttggcc--tcaaaagaa----acgcggtaatcgg------------
A0A2R9BPJ5_MCL1-03      atgtttggcc--tcaaaagaa----acgcggtaatcgg------------
A0A2R8Z9D7_BCL2L1-      --------------------atgtctcagagcaaccgggagctggtggtt
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      atggcgaccc-----cagcctcagccccagacacacgggctctggtggca
A0A2R9A2Q3_BCL2L2-      atggcgaccc-----cagcctcagccccagacacacgggctctggtggca
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
                                                                          

A0A2R8ZJ66_BCL2A1-      gactatctgcagtacgtcctac-----agataccac--------------
A0A2R8ZJ66_BCL2A1-      gactatctgcagtacgtcctac-----agataccac--------------
A0A2R8ZJ66_BCL2A1-      gactatctgcagtacgtcctac-----agataccac--------------
A0A2R9BCD9_BCL2L10      -----------------cccgctgcgggagcgcacc--------------
A0A2R9APW6_BCL2-01      aagtacatccattataagctgtcgcagaggggctac--------------
A0A2R9BPJ5_MCL1-02      ------actcaacct---ctactgtgggggggc--c--------------
A0A2R9BPJ5_MCL1-01      ------actcaacct---ctactgtgggggggc--c--------------
A0A2R9BPJ5_MCL1-03      ------actcaacct---ctactgtgggggggc--c--------------
A0A2R8Z9D7_BCL2L1-      gactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      gactttgtaggttataagctgaggcagaagggttatgtctgt--------
A0A2R9A2Q3_BCL2L2-      gactttgtaggttataagctgaggcagaagggttatgtctgt--------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
                                                                          

A0A2R8ZJ66_BCL2A1-      ----------------aacctggatcaggtccaagccaaacgt-------
A0A2R8ZJ66_BCL2A1-      ----------------aacctggatcaggtccaagccaaacgt-------
A0A2R8ZJ66_BCL2A1-      ----------------aacctggatcaggtccaagccaaacgt-------
A0A2R9BCD9_BCL2L10      ---------------------gagc-ggttgctggccgactac----ctg
A0A2R9APW6_BCL2-01      ---------------------gagtgggatgcgggaga---------tgt
A0A2R9BPJ5_MCL1-02      ---------------------ggcttgggggccggcag---------cgg
A0A2R9BPJ5_MCL1-01      ---------------------ggcttgggggccggcag---------cgg
A0A2R9BPJ5_MCL1-03      ---------------------ggcttgggggccggcag---------cgg
A0A2R8Z9D7_BCL2L1-      tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcgg
A0A2R8Z9D7_BCL2L1-      -----atgtggaagagaacaggactgaggccccagaagggactgaatcgg
A0A2R9A2Q3_BCL2L2-      --------------------ggagctggccccggggagggccc-------
A0A2R9A2Q3_BCL2L2-      --------------------ggagctggccccggggagggccc-------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
                                                                          

A0A2R8ZJ66_BCL2A1-      ----------ccagagtgctacaaaatgttgcattctcagtccaaaaaga
A0A2R8ZJ66_BCL2A1-      ----------ccagagtgctacaaaatgttgcattctcagtccaaaaaga
A0A2R8ZJ66_BCL2A1-      ----------ccagagtgctacaaaatgttgcattctcagtccaaaaaga
A0A2R9BCD9_BCL2L10      gggtactgcgcccgggaaccc------ggcac------------------
A0A2R9APW6_BCL2-01      gggcgccgcgcccctcagccc------ggtgccacctgtgg---------
A0A2R9BPJ5_MCL1-02      cggcgccacccctccggg---------agggcgacttttggctacggaga
A0A2R9BPJ5_MCL1-01      cggcgccacccctccggg---------agggcgacttttggctacggaga
A0A2R9BPJ5_MCL1-03      cggcgccacccctccggg---------agggcgactttt-----------
A0A2R8Z9D7_BCL2L1-      agatggagacccccagtgccatcaatggcaacccatcctggcacctggcg
A0A2R8Z9D7_BCL2L1-      agatggagacccccagtgccatcaatggcaacccatcct-----------
A0A2R9A2Q3_BCL2L2-      agcagctgacccgctgcacca-----------------------------
A0A2R9A2Q3_BCL2L2-      agcagctgacccgctgcacca-----------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
                                                                          

A0A2R8ZJ66_BCL2A1-      agtgga--------------------------------------------
A0A2R8ZJ66_BCL2A1-      agtgga--------------------------------------------
A0A2R8ZJ66_BCL2A1-      agtgga--------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-02      aggaggcctcggcccggcgagagatagggggaggggaggccggcgcggtg
A0A2R9BPJ5_MCL1-01      aggaggcctcggcccggcgagagatagggggaggggaggccggcgcggtg
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      gacagccccgcggtgaatggagccactggccacagcagcagtttggatgc
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
                                                                          

A0A2R8ZJ66_BCL2A1-      ----------------------------------------aaagaatctg
A0A2R8ZJ66_BCL2A1-      ----------------------------------------aaagaatctg
A0A2R8ZJ66_BCL2A1-      ----------------------------------------aaagaatctg
A0A2R9BCD9_BCL2L10      ----------------------------------------ccccgagccg
A0A2R9APW6_BCL2-01      --------------------------tccacctgaccctccgccaggccg
A0A2R9BPJ5_MCL1-02      attggcggaagcgccggcgcaagccccccgtccaccctcacgccagactc
A0A2R9BPJ5_MCL1-01      attggcggaagcgccggcgcaagccccccgtccaccctcacgccagactc
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      ccgggaggtgatccccatggcagcagtaaagcaagcgctgagggaggcag
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      ---------------------------------agccatgcgggcagctg
A0A2R9A2Q3_BCL2L2-      ---------------------------------agccatgcgggcagctg
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
                                                                          

A0A2R8ZJ66_BCL2A1-      aagtcatgcttggacaatgttaat--------------gttgtgtctgta
A0A2R8ZJ66_BCL2A1-      aagtcatgcttggacaatgttaat--------------gttgtgtctgta
A0A2R8ZJ66_BCL2A1-      aagtcatgcttggacaatgttaat--------------gttgtgtctgta
A0A2R9BCD9_BCL2L10      acgccgtccacgcccgaggccgcc-----gtgctgcgctccgcggc--cg
A0A2R9APW6_BCL2-01      gcgacgacttctcccgccgctacc--------------gccgcgacttcg
A0A2R9BPJ5_MCL1-02      ccggagggtcgcgcggccgccgcccattggcgccgaggtccccgacgtca
A0A2R9BPJ5_MCL1-01      ccggagggtcgcgcggccgccgcccattggcgccgaggtccccgacgtca
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      gcgacgagtttgaactgcggtacc--------------ggcgggcattca
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      gagatgagttcgagacccgcttcc--------------ggcgcaccttct
A0A2R9A2Q3_BCL2L2-      gagatgagttcgagacccgcttcc--------------ggcgcaccttct
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
                                                                          

A0A2R8ZJ66_BCL2A1-      --------------------------------------------gacact
A0A2R8ZJ66_BCL2A1-      --------------------------------------------gacact
A0A2R8ZJ66_BCL2A1-      --------------------------------------------gacact
A0A2R9BCD9_BCL2L10      ccaggttacggcagatccaccggtccttcttctccgcctacctcggctac
A0A2R9APW6_BCL2-01      ccgagatgtcc---agccagctgcacctgacgccc-ttcaccgcg-----
A0A2R9BPJ5_MCL1-02      ccgcgacccccgcgaggctgcttttcttcgcgcccacccgccgcg-----
A0A2R9BPJ5_MCL1-01      ccgcgacccccgcgaggctgcttttcttcgcgcccacccgccgcg-----
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      gtgacctgaca---tcccagctccacatcacccca---------gggaca
A0A2R8Z9D7_BCL2L1-      --------------------------------------------gggaca
A0A2R9A2Q3_BCL2L2-      ctgatctggcg---gctcagctgcatgtgacccca---------ggctca
A0A2R9A2Q3_BCL2L2-      ctgatctggcg---gctcagctgcatgtgacccca---------ggctca
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
                                                                          

A0A2R8ZJ66_BCL2A1-      gccagaacactatt--------------------------caaccaagtg
A0A2R8ZJ66_BCL2A1-      gccagaacactatt--------------------------caaccaagtg
A0A2R8ZJ66_BCL2A1-      gccagaacactatt--------------------------caaccaagtg
A0A2R9BCD9_BCL2L10      cccgggaaccgctt--------------------------cgagctggtg
A0A2R9APW6_BCL2-01      ---cggggacgctt--------------------------tgccacggtg
A0A2R9BPJ5_MCL1-02      ---cggcgccgcttgaggagatggaagccccggccgccgacgccatcatg
A0A2R9BPJ5_MCL1-01      ---cggcgccgcttgaggagatggaagccccggccgccgacgccatcatg
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      gcatatcagagctt--------------------------tgaacaggta
A0A2R8Z9D7_BCL2L1-      gcatatcagagctt--------------------------tgaacaggta
A0A2R9A2Q3_BCL2L2-      gcccaacaacgctt--------------------------cacccaggtc
A0A2R9A2Q3_BCL2L2-      gcccaacaacgctt--------------------------cacccaggtc
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
                                                                          

A0A2R8ZJ66_BCL2A1-      atg---gaaaaggagtt---------------------------------
A0A2R8ZJ66_BCL2A1-      atg---gaaaaggagtt---------------------------------
A0A2R8ZJ66_BCL2A1-      atg---gaaaaggagtt---------------------------------
A0A2R9BCD9_BCL2L10      gcgctgatggcggattc---------------------------------
A0A2R9APW6_BCL2-01      gtg------gaggagct---------------------------------
A0A2R9BPJ5_MCL1-02      tcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagcg
A0A2R9BPJ5_MCL1-01      tcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagcg
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      gtg------aatgaact---------------------------------
A0A2R8Z9D7_BCL2L1-      gtg------aatgaact---------------------------------
A0A2R9A2Q3_BCL2L2-      tcc------gatgaact---------------------------------
A0A2R9A2Q3_BCL2L2-      tcc------gatgaact---------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
                                                                          

A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-02      gccggctgtcctgcctctgctggagttggtcggggaatctggtaataaca
A0A2R9BPJ5_MCL1-01      gccggctgtcctgcctctgctggagttggtcggggaatctggtaataaca
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
                                                                          

A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R9BCD9_BCL2L10      ------cgtgctctccgacagccccggccccacctggggcagagtgg---
A0A2R9APW6_BCL2-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-02      ccagtacggacgggtcactaccctcgacgccgccgccagcagaggaggag
A0A2R9BPJ5_MCL1-01      ccagtacggacgggtcactaccctcgacgccgccgccagcagaggaggag
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
                                                                          

A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------tgacgctcgtgaccttcg
A0A2R9APW6_BCL2-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-02      gaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
A0A2R9BPJ5_MCL1-01      gaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
                                                                          

A0A2R8ZJ66_BCL2A1-      ------------------tgaagatggcatcattaactggggaagaattg
A0A2R8ZJ66_BCL2A1-      ------------------tgaagatggcatcattaactggggaagaattg
A0A2R8ZJ66_BCL2A1-      ------------------tgaagatggcatcattaactggggaagaattg
A0A2R9BCD9_BCL2L10      ------------------cagggacgctgctg--gagagagggccgctgg
A0A2R9APW6_BCL2-01      ---------------cttcagggacgggg-tg--aactgggggaggattg
A0A2R9BPJ5_MCL1-02      ggagcaggccaccggcgccaaggacacaa-ag--ccaatgggcaggtctg
A0A2R9BPJ5_MCL1-01      ggagcaggccaccggcgccaaggacacaa-ag--ccaatgggcaggtctg
A0A2R9BPJ5_MCL1-03      ------ggccaccggcgccaaggacacaa-ag--ccaatgggcaggtctg
A0A2R8Z9D7_BCL2L1-      ---------------cttccgggatgggg-ta--aactggggtcgcattg
A0A2R8Z9D7_BCL2L1-      ---------------cttccgggatgggg-ta--aactggggtcgcattg
A0A2R9A2Q3_BCL2L2-      ---------------ttttcaagggggcc-cc--aactggggccgccttg
A0A2R9A2Q3_BCL2L2-      ---------------ttttcaagggggcc-cc--aactggggccgccttg
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
                                                                          

A0A2R8ZJ66_BCL2A1-      taaccata--tttgcatttgaaggtattctcatcaagaaacttctacgac
A0A2R8ZJ66_BCL2A1-      taaccata--tttgcatttgaaggtattctcatcaagaaacttctacgac
A0A2R8ZJ66_BCL2A1-      taaccata--tttgcatttgaaggtattctcatcaagaaacttctacgac
A0A2R9BCD9_BCL2L10      tgaccacccggtggaagaagtggggcttcca-----------------gc
A0A2R9APW6_BCL2-01      tggccttc--tttgagttcggtggggtcat--------------------
A0A2R9BPJ5_MCL1-02      gggccaccagcaggaaggcgctggagacctt-----------------ac
A0A2R9BPJ5_MCL1-01      gggccaccagcaggaaggcgctggagacctt-----------------ac
A0A2R9BPJ5_MCL1-03      gggccaccagcaggaaggcgctggagacctt-----------------ac
A0A2R8Z9D7_BCL2L1-      tggccttt--ttctccttcggcggggcact--------------------
A0A2R8Z9D7_BCL2L1-      tggccttt--ttctccttcggcggggcact--------------------
A0A2R9A2Q3_BCL2L2-      tagccttc--tttgtctttggggctgcact--------------------
A0A2R9A2Q3_BCL2L2-      tagccttc--tttgtctttggggctgcact--------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
                                                                          

A0A2R8ZJ66_BCL2A1-      agcagattgccccggatgtggatacttataaggagatttcata-------
A0A2R8ZJ66_BCL2A1-      agcagattgccccggatgtggatacttataaggagatttcata-------
A0A2R8ZJ66_BCL2A1-      agcagattgccccggatgtggatacttataaggagatttcata-------
A0A2R9BCD9_BCL2L10      cgcggctaaaggag-----------caggagggcgacgtcgccc------
A0A2R9APW6_BCL2-01      ----gtgtgtggagagcgt------caaccgggagatgtcgcccctgg--
A0A2R9BPJ5_MCL1-02      gacgggttggggatggcgtgcagcgcaaccatgagacggccttccaa---
A0A2R9BPJ5_MCL1-01      gacgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggc
A0A2R9BPJ5_MCL1-03      gacgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggc
A0A2R8Z9D7_BCL2L1-      ----gtgcgtggaaagcgt------agacaaggagatgcaggtattggt-
A0A2R8Z9D7_BCL2L1-      ----gtgcgtggaaagcgt------agacaaggagatgcaggtattggt-
A0A2R9A2Q3_BCL2L2-      ----gtgtgctgagagtgt------caacaaggagatggaaccactggt-
A0A2R9A2Q3_BCL2L2-      ----gtgtgctgagagtgt------caacaaggagatggaaccactggt-
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
                                                                          

A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R9BCD9_BCL2L10      -------------gggactgccagcgcc----------------------
A0A2R9APW6_BCL2-01      -------------tggac-aacatcgcc----------------------
A0A2R9BPJ5_MCL1-02      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      atgcttcggaaactggac-atcaaaaacgaagacgatgtgaaatcgttgt
A0A2R9BPJ5_MCL1-03      atgcttcggaaactggac-atcaaaaacgaagacgatgtgaaatcgttgt
A0A2R8Z9D7_BCL2L1-      -------------gagtcggatcgcagc----------------------
A0A2R8Z9D7_BCL2L1-      -------------gagtcggatcgcagc----------------------
A0A2R9A2Q3_BCL2L2-      -------------gggacaagtgcagga----------------------
A0A2R9A2Q3_BCL2L2-      -------------gggacaagtgcagga----------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
                                                                          

A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-02      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      ctcgagtgatgatccatgttttcagcgacggcgtaacaaactggggcagg
A0A2R9BPJ5_MCL1-03      ctcgagtgatgatccatgttttcagcgacggcgtaacaaactggggcagg
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
                                                                          

A0A2R8ZJ66_BCL2A1-      ------------------ttttgttgcggagttcataatgaataacacag
A0A2R8ZJ66_BCL2A1-      ------------------ttttgttgcggagttcataatgaataacacag
A0A2R8ZJ66_BCL2A1-      ------------------ttttgttgcggagttcataatgaataacacag
A0A2R9BCD9_BCL2L10      -----------tggtggccttgctgagctcgcggctcgtggggcagcacc
A0A2R9APW6_BCL2-01      ----------------ctgtggatgactgagtacctgaaccggcacctgc
A0A2R9BPJ5_MCL1-02      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      attgtgactctcatttcttttggtgcctttgtggctaaa----cacttga
A0A2R9BPJ5_MCL1-03      attgtgactctcatttcttttggtgcctttgtggctaaa----cacttga
A0A2R8Z9D7_BCL2L1-      ------------------ttggatggccacttacctgaatgaccacctag
A0A2R8Z9D7_BCL2L1-      ------------------ttggatggccacttacctgaatgaccacctag
A0A2R9A2Q3_BCL2L2-      ------------------gtggatggtggcctacctggagacgcggctgg
A0A2R9A2Q3_BCL2L2-      ------------------gtggatggtggcctacctggagacgcggctgg
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
                                                                          

A0A2R8ZJ66_BCL2A1-      gagaatggataagacaaaac------------------------------
A0A2R8ZJ66_BCL2A1-      gagaatggataagacaaaac------------------------------
A0A2R8ZJ66_BCL2A1-      gagaatggataagacaaaac------------------------------
A0A2R9BCD9_BCL2L10      gcgcctggctgcaggctcag------------------------------
A0A2R9APW6_BCL2-01      acacctggatccaggataac------------------------------
A0A2R9BPJ5_MCL1-02      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      agaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcaca
A0A2R9BPJ5_MCL1-03      agaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcaca
A0A2R8Z9D7_BCL2L1-      agccttggatccaggagaac------------------------------
A0A2R8Z9D7_BCL2L1-      agccttggatccaggagaac------------------------------
A0A2R9A2Q3_BCL2L2-      ctgactggatccacagcagt------------------------------
A0A2R9A2Q3_BCL2L2-      ctgactggatccacagcagt------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
                                                                          

A0A2R8ZJ66_BCL2A1-      ------------------------------------------ggaggctg
A0A2R8ZJ66_BCL2A1-      ------------------------------------------ggaggct-
A0A2R8ZJ66_BCL2A1-      ------------------------------------------ggaggct-
A0A2R9BCD9_BCL2L10      ------------------------------------------ggcggctg
A0A2R9APW6_BCL2-01      ------------------------------------------ggaggctg
A0A2R9BPJ5_MCL1-02      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      gacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctg
A0A2R9BPJ5_MCL1-03      gacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctg
A0A2R8Z9D7_BCL2L1-      ------------------------------------------ggcggctg
A0A2R8Z9D7_BCL2L1-      ------------------------------------------ggcggctg
A0A2R9A2Q3_BCL2L2-      ------------------------------------------gggggctg
A0A2R9A2Q3_BCL2L2-      ------------------------------------------gggggctg
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
                                                                          

A0A2R8ZJ66_BCL2A1-      gggga---------------------------------------------
A0A2R8ZJ66_BCL2A1-      gggaa---------------------------------------------
A0A2R8ZJ66_BCL2A1-      gggaa---------------------------------------------
A0A2R9BCD9_BCL2L10      g-------------------------------------------------
A0A2R9APW6_BCL2-01      g-------------------------------------------------
A0A2R9BPJ5_MCL1-02      g-------------------------------------------------
A0A2R9BPJ5_MCL1-01      g-------------------------------------------------
A0A2R9BPJ5_MCL1-03      g-------------------------------------------------
A0A2R8Z9D7_BCL2L1-      g-------------------------------------------------
A0A2R8Z9D7_BCL2L1-      g-------------------------------------------------
A0A2R9A2Q3_BCL2L2-      ggcg----------------------------------------------
A0A2R9A2Q3_BCL2L2-      ggagctggaagctatcaaagctcgagtcagggagatggaggaagaagctg
A0A2R9A2Q3_BCL2L2-      ----------------------------------atggaggaagaagctg
                                                                          

A0A2R8ZJ66_BCL2A1-      ----------------------------------------------aatg
A0A2R8ZJ66_BCL2A1-      ----------------------------------------------aatg
A0A2R8ZJ66_BCL2A1-      ----------------------------------------------aatg
A0A2R9BCD9_BCL2L10      ----------------------------------------------gatg
A0A2R9APW6_BCL2-01      ----------------------------------------------gatg
A0A2R9BPJ5_MCL1-02      ----------------------------------------------gatg
A0A2R9BPJ5_MCL1-01      ----------------------------------------------gatg
A0A2R9BPJ5_MCL1-03      ----------------------------------------------gatg
A0A2R8Z9D7_BCL2L1-      ----------------------------------------------gata
A0A2R8Z9D7_BCL2L1-      ----------------------------------------------gata
A0A2R9A2Q3_BCL2L2-      ----------------------------------------------gagt
A0A2R9A2Q3_BCL2L2-      agaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagt
A0A2R9A2Q3_BCL2L2-      agaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagt
                                                                       *  

A0A2R8ZJ66_BCL2A1-      gc---------acaatc---------------------------------
A0A2R8ZJ66_BCL2A1-      gctttgtaaagaagttt---------------------------------
A0A2R8ZJ66_BCL2A1-      gctttgtaaagaagttt---------------------------------
A0A2R9BCD9_BCL2L10      gcttttgtcacttcttc-------aggacc--------------------
A0A2R9APW6_BCL2-01      cctttgtggaactgtac--------ggccc--------------------
A0A2R9BPJ5_MCL1-02      ggtttgtggagttcttccatgtagaggacc--------------------
A0A2R9BPJ5_MCL1-01      ggtttgtggagttcttccatgtagaggacc--------------------
A0A2R9BPJ5_MCL1-03      ggtttgtggagttcttccatgtagaggacc--------------------
A0A2R8Z9D7_BCL2L1-      cttttgtggaactctat-------gggaacaatg----------------
A0A2R8Z9D7_BCL2L1-      cttttgtggaactctat-------gggaacaatg----------------
A0A2R9A2Q3_BCL2L2-      tcacagct---ctatac-------ggggacgg-------ggccctggagg
A0A2R9A2Q3_BCL2L2-      ccaccaccaggcaatgc-------tggcccagtgatcatgtccattgagg
A0A2R9A2Q3_BCL2L2-      ccaccaccaggcaatgc-------tggcccagtgatcatgtccattgagg
                                                                          

A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-02      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      aggcg-cggcgtctg-----------------------------------
A0A2R9A2Q3_BCL2L2-      agaagatggaggctgatgcccgttccatctatgttggcaatgtggactat
A0A2R9A2Q3_BCL2L2-      agaagatggaggctgatgcccgttccatctatgttggcaatgtggactat
                                                                          

A0A2R8ZJ66_BCL2A1-      ---------acacgcctatgctgg--------------------------
A0A2R8ZJ66_BCL2A1-      ---------gaacataaat-ctgg--------------------------
A0A2R8ZJ66_BCL2A1-      ---------gaacataaat-ctgg--------------------------
A0A2R9BCD9_BCL2L10      -------cc-----------------------------------------
A0A2R9APW6_BCL2-01      -------cagcatgcggcctctg---------------------------
A0A2R9BPJ5_MCL1-02      -------tagaaggtggcatcagg--------------------------
A0A2R9BPJ5_MCL1-01      -------tagaaggtggcatcagg--------------------------
A0A2R9BPJ5_MCL1-03      -------tagaaggtggcatcagg--------------------------
A0A2R8Z9D7_BCL2L1-      -------cagcagccgagagccga--------------------------
A0A2R8Z9D7_BCL2L1-      -------cagcagccgagagccga--------------------------
A0A2R9A2Q3_BCL2L2-      -------cgggag--gggaactgg--------------------------
A0A2R9A2Q3_BCL2L2-      ggtgcaacagcag--aagagctggaagctcactttcatggctgtggttca
A0A2R9A2Q3_BCL2L2-      ggtgcaacagcag--aagagctggaagctcactttcatggctgtggttca
                                                                          

A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-02      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      gtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaagg
A0A2R9A2Q3_BCL2L2-      gtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaagg
                                                                          

A0A2R8ZJ66_BCL2A1-      ------------------------------tagagtcagtggcccacaag
A0A2R8ZJ66_BCL2A1-      ------------------------------ctggatgacttttctagaag
A0A2R8ZJ66_BCL2A1-      ------------------------------ctggatgacttttctagaag
A0A2R9BCD9_BCL2L10      ---------------------------------------ctttccgctgg
A0A2R9APW6_BCL2-01      -----------------------------------tttgatttctcctgg
A0A2R9BPJ5_MCL1-02      ---------------------------------aatgtg----ctgctgg
A0A2R9BPJ5_MCL1-01      ---------------------------------aatgtg----ctgctgg
A0A2R9BPJ5_MCL1-03      ---------------------------------aatgtg----ctgctgg
A0A2R8Z9D7_BCL2L1-      --------------------------aagggccag-gaacgcttcaaccg
A0A2R8Z9D7_BCL2L1-      --------------------------aagggccag-gaacgcttcaaccg
A0A2R9A2Q3_BCL2L2-      ----------------------------gcatcagtgaggac--------
A0A2R9A2Q3_BCL2L2-      gtttgcgtatatagagttctcagacaaagagtcagtgaggacttccttgg
A0A2R9A2Q3_BCL2L2-      gtttgcgtatatagagttctcagacaaagagtcagtgaggacttccttgg
                                                                          

A0A2R8ZJ66_BCL2A1-      aagaggaaaatggc------------------------------------
A0A2R8ZJ66_BCL2A1-      ttacaggaaagatc---------------------------------tgt
A0A2R8ZJ66_BCL2A1-      ttacaggaaagatctcaatactgttgaccagaaaggacactccatattgt
A0A2R9BCD9_BCL2L10      ct-ttttggagaaa-----acagctggtccaggcttttctgtcatg----
A0A2R9APW6_BCL2-01      ctgtctctgaagac-----tctgctcagtttggc-----------c----
A0A2R9BPJ5_MCL1-02      ct---tttgcaggt-----gttgctggagtagga-----------g----
A0A2R9BPJ5_MCL1-01      ct---tttgcaggt-----gttgctggagtagga-----------g----
A0A2R9BPJ5_MCL1-03      ct---tttgcaggt-----gttgctggagtagga-----------g----
A0A2R8Z9D7_BCL2L1-      ct-------ggttc-----ct-----gacgggcatgact----gtg----
A0A2R8Z9D7_BCL2L1-      ct-------ggttc-----ct-----gacgggcatgact----gtg----
A0A2R9A2Q3_BCL2L2-      ---------agtgc-----t------gacgggggcc-------gtg----
A0A2R9A2Q3_BCL2L2-      ccttagatgagtcc-----ctatttagaggaaggcaaatcaaggtgatcc
A0A2R9A2Q3_BCL2L2-      ccttagatgagtcc-----ctatttagaggaaggcaaatcaaggtgatcc
                                                                          

A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      gaaat---gctatc----------tctcct----------gaagcaa---
A0A2R8ZJ66_BCL2A1-      gaaaccggcctaat----------ttttctgactgttatggaaacgattg
A0A2R9BCD9_BCL2L10      ---------cttgt-------------------------------taaca
A0A2R9APW6_BCL2-01      ---------ctggt-------------------------gggagcttgca
A0A2R9BPJ5_MCL1-02      ---------ctggt-------------------------------ttg--
A0A2R9BPJ5_MCL1-01      ---------ctggt-------------------------------ttg--
A0A2R9BPJ5_MCL1-03      ---------ctggt-------------------------------ttg--
A0A2R8Z9D7_BCL2L1-      --------gccggc-------------------------gtggttct---
A0A2R8Z9D7_BCL2L1-      --------gccggc-------------------------gtggttct---
A0A2R9A2Q3_BCL2L2-      ------gcactgggggccctggtaactgta---------ggggcctt---
A0A2R9A2Q3_BCL2L2-      caaaacgaaccaacagaccaggcatcagcacaacagaccggggttttcca
A0A2R9A2Q3_BCL2L2-      caaaacgaaccaacagaccaggcatcagcacaacagaccggggttttcca
                                                                          

A0A2R8ZJ66_BCL2A1-      ----------------tttg------------------------------
A0A2R8ZJ66_BCL2A1-      --------------tactgt------------------------------
A0A2R8ZJ66_BCL2A1-      ccaacacatacttctacttt------------------------------
A0A2R9BCD9_BCL2L10      acagccttcatttatctctg--------gacacgattatta---------
A0A2R9APW6_BCL2-01      tcaccctgggtgcctatctgggccacaagtga------------------
A0A2R9BPJ5_MCL1-02      -----------gcatatcta----ataagatagccttactg---------
A0A2R9BPJ5_MCL1-01      -----------gcatatcta----ataagatag-----------------
A0A2R9BPJ5_MCL1-03      -----------gcatatcta----ataagatag-----------------
A0A2R8Z9D7_BCL2L1-      ---------------gctgggctcact-----------------------
A0A2R8Z9D7_BCL2L1-      ---------------gctgggctcact-----------------------
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      cgagcccgctaccgcgcccggaccaccaactacaacagttcccgctctcg
A0A2R9A2Q3_BCL2L2-      cgagcccgctaccgcgcccggaccaccaactacaacagttcccgctctcg
                                                                          

A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R8ZJ66_BCL2A1-      --------------------------------------------------
A0A2R9BCD9_BCL2L10      --------------------------------------------------
A0A2R9APW6_BCL2-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-02      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      ------------cttcagtcggaaa-------------------------
A0A2R8Z9D7_BCL2L1-      ------------cttcagtcggaaa-------------------------
A0A2R9A2Q3_BCL2L2-      ------------ttttgctagcaag-------------------------
A0A2R9A2Q3_BCL2L2-      attctacagtggttttaacagcaggccccggggtcgcgtctacaggggcc
A0A2R9A2Q3_BCL2L2-      attctacagtggttttaacagcaggccccggggtcgcgtctaca--ggtc
                                                                          

A0A2R8ZJ66_BCL2A1-      --------------------------------taa
A0A2R8ZJ66_BCL2A1-      --------------------------------tga
A0A2R8ZJ66_BCL2A1-      --------------------------------taa
A0A2R9BCD9_BCL2L10      --------------------------------tga
A0A2R9APW6_BCL2-01      -----------------------------------
A0A2R9BPJ5_MCL1-02      --------------------------------taa
A0A2R9BPJ5_MCL1-01      -----------------------------------
A0A2R9BPJ5_MCL1-03      -----------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------tga
A0A2R8Z9D7_BCL2L1-      --------------------------------tga
A0A2R9A2Q3_BCL2L2-      --------------------------------tga
A0A2R9A2Q3_BCL2L2-      gggctagagcgacatcatggtattccccttactaa
A0A2R9A2Q3_BCL2L2-      aggatag----------------------------
                                                           

© 1998-2022Legal notice