Dataset for CDS BCL2L1 of organism Felis catus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q8SQ42_BCL2L1-01      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
M3XA94_BCL2L1-01      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
M3XA94_BCL2L1-03      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
M3XA94_BCL2L1-02      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
                      **************************************************

Q8SQ42_BCL2L1-01      ttcccagaaaggatacagctggagtcggtttagtgatgtggaagagaaca
M3XA94_BCL2L1-01      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
M3XA94_BCL2L1-03      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
M3XA94_BCL2L1-02      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
                      ************************** ***********************

Q8SQ42_BCL2L1-01      gaactgaggccccagaagggactgaatcagagatggagacccccagtgcc
M3XA94_BCL2L1-01      gaactgaggccccagaagggactgaatcagagatggagacccccagtgcc
M3XA94_BCL2L1-03      gaactgaggccccagaagggactgaatcagagatggagacccccagtgcc
M3XA94_BCL2L1-02      gaactgaggccccagaagggactgaatcagagatggagacccccagtgcc
                      **************************************************

Q8SQ42_BCL2L1-01      atcaatggcaacccatcctggcacttggcagacagccctgcggtgaatgg
M3XA94_BCL2L1-01      atcaatggcaacccatcctggcacttggcggacagccctgcggtgaatgg
M3XA94_BCL2L1-03      atcaatggcaacccatcctggcacttggcggacagccctgcggtgaatgg
M3XA94_BCL2L1-02      atcaatggcaacccatcctggcacttggcggacagccctgcggtgaatgg
                      ***************************** ********************

Q8SQ42_BCL2L1-01      agccactggccacagcagcagcttggatgcccgggaggtgatccccatgg
M3XA94_BCL2L1-01      agccactggccacagcagcagcttggatgcccgggaggtgatccccatgg
M3XA94_BCL2L1-03      agccactggccacagcagcagcttggatgcccgggaggtgatccccatgg
M3XA94_BCL2L1-02      agccactggccacagcagcagcttggatgcccgggaggtgatccccatgg
                      **************************************************

Q8SQ42_BCL2L1-01      cagcggtcaaacaagcgctgagggaggctggggatgagtttgaactgagg
M3XA94_BCL2L1-01      cagcggtgaagcaggcgctgagggaggccggggatgagtttgaactgagg
M3XA94_BCL2L1-03      cagcggtgaagcaggcgctgagggaggccggggatgagtttgaactgagg
M3XA94_BCL2L1-02      cagcggtgaagcaggcgctgagggaggccggggatgagtttgaactgagg
                      ******* ** ** ************** *********************

Q8SQ42_BCL2L1-01      taccggcgggcattcagtgacctgacatcccagcttcacatcaccccagg
M3XA94_BCL2L1-01      taccggcgggcattcagcgacctgacatcccagcttcacatcaccccagg
M3XA94_BCL2L1-03      taccggcgggcattcagcgacctgacatcccagcttcacatcaccccagg
M3XA94_BCL2L1-02      taccggcgggcattcagcgacctgacatcccagcttcacatcaccccagg
                      ***************** ********************************

Q8SQ42_BCL2L1-01      gacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
M3XA94_BCL2L1-01      gacagcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
M3XA94_BCL2L1-03      gacagcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
M3XA94_BCL2L1-02      gacagcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
                      ********************************* ****************

Q8SQ42_BCL2L1-01      gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactg
M3XA94_BCL2L1-01      gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactg
M3XA94_BCL2L1-03      gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactg
M3XA94_BCL2L1-02      gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactg
                      **************************************************

Q8SQ42_BCL2L1-01      tgcgtggagagcgtagacaaggagatgcaggtattggtgagtcggatcgc
M3XA94_BCL2L1-01      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
M3XA94_BCL2L1-03      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
M3XA94_BCL2L1-02      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
                      ******** *****************************************

Q8SQ42_BCL2L1-01      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
M3XA94_BCL2L1-01      aacttggatggccacttacctgaacgaccacctagagccttggatccagg
M3XA94_BCL2L1-03      aacttggatggccacttacctgaacgaccacctagagccttggatccagg
M3XA94_BCL2L1-02      aacttggatggccacttacctgaacgaccacctagagccttggatccagg
                      * ********************** *************************

Q8SQ42_BCL2L1-01      agaacggcggctgggatacttttgtggaactctacgggaacaatgcagca
M3XA94_BCL2L1-01      agaacggcggctgggttgttattgagcaccaacggtgtgcca-------g
M3XA94_BCL2L1-03      agaacggcggctggg-----------------------------------
M3XA94_BCL2L1-02      agaacggcggctgggacacttttgtggaactctacgggaacaatgcagcg
                      ***************                                   

Q8SQ42_BCL2L1-01      gccgagagccggaagggccaggagcgctccaac-----------------
M3XA94_BCL2L1-01      gctctgtgctccacagggt------gcacacagcccagaacaaagcagcc
M3XA94_BCL2L1-03      -------tctggactggct-------------------------------
M3XA94_BCL2L1-02      gccgagagccggaagggccaggtcagaacaaacgccgaaacagagctgcc
                              *   *  **                                 

Q8SQ42_BCL2L1-01      -----------------------------cgctggttcctga-----cag
M3XA94_BCL2L1-01      catggag----------------------cacctcttctagagaaaggag
M3XA94_BCL2L1-03      -----------------------------tattttaccctgagttc-ctg
M3XA94_BCL2L1-02      acagagagtttgtccggtcctggggacgacgccttgcctggatttcgctg
                                                           *  **       *

Q8SQ42_BCL2L1-01      gcatga-------------------------------------ctgtggc
M3XA94_BCL2L1-01      acacga-----------cggacaaggaaacaaacaagattgttccgggga
M3XA94_BCL2L1-03      gcacag------------ggcctg--aggttgggtaa-------------
M3XA94_BCL2L1-02      ggacgggaagggactgttggcctggaaggtggaggaaacctcctttgggc
                        *                                               

Q8SQ42_BCL2L1-01      tggcgtgg-----ttctgct--gggctcactcttcagtcggaaa------
M3XA94_BCL2L1-01      taaattg------ttctgcaaccaactacccc--------aaaacttaa-
M3XA94_BCL2L1-03      gggcttggccagcatctgct--caatgaacat---------gaggttatt
M3XA94_BCL2L1-02      gggtctgacca--ctctgca--cagctcccgtcccagggcagaagttccc
                           **       *****          *            *       

Q8SQ42_BCL2L1-01      -----------------tga
M3XA94_BCL2L1-01      ---------------gctaa
M3XA94_BCL2L1-03      attagatgcag----gttag
M3XA94_BCL2L1-02      ggaggagggggcggtgctga
                                       *  

© 1998-2020Legal notice