Dataset for CDS BCL2L1 of organism Felis catus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q8SQ42_BCL2L1-01        atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
A0A5F5XYW0_BCL2L1-      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
A0A5F5XYW0_BCL2L1-      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
A0A5F5XYW0_BCL2L1-      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
                        **************************************************

Q8SQ42_BCL2L1-01        ttcccagaaaggatacagctggagtcggtttagtgatgtggaagagaaca
A0A5F5XYW0_BCL2L1-      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
A0A5F5XYW0_BCL2L1-      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
A0A5F5XYW0_BCL2L1-      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
                        ************************** ***********************

Q8SQ42_BCL2L1-01        gaactgaggccccagaagggactgaatcagagatggagacccccagtgcc
A0A5F5XYW0_BCL2L1-      gaactgaggccccagaagggactgaatcagagatggagacccccagtgcc
A0A5F5XYW0_BCL2L1-      gaactgaggccccagaagggactgaatcagagatggagacccccagtgcc
A0A5F5XYW0_BCL2L1-      gaactgaggccccagaagggactgaatcagagatggagacccccagtgcc
                        **************************************************

Q8SQ42_BCL2L1-01        atcaatggcaacccatcctggcacttggcagacagccctgcggtgaatgg
A0A5F5XYW0_BCL2L1-      atcaatggcaacccatcctggcacttggcggacagccctgcggtgaatgg
A0A5F5XYW0_BCL2L1-      atcaatggcaacccatcctggcacttggcggacagccctgcggtgaatgg
A0A5F5XYW0_BCL2L1-      atcaatggcaacccatcctggcacttggcggacagccctgcggtgaatgg
                        ***************************** ********************

Q8SQ42_BCL2L1-01        agccactggccacagcagcagcttggatgcccgggaggtgatccccatgg
A0A5F5XYW0_BCL2L1-      agccactggccacagcagcagcttggatgcccgggaggtgatccccatgg
A0A5F5XYW0_BCL2L1-      agccactggccacagcagcagcttggatgcccgggaggtgatccccatgg
A0A5F5XYW0_BCL2L1-      agccactggccacagcagcagcttggatgcccgggaggtgatccccatgg
                        **************************************************

Q8SQ42_BCL2L1-01        cagcggtcaaacaagcgctgagggaggctggggatgagtttgaactgagg
A0A5F5XYW0_BCL2L1-      cagcggtgaagcaggcgctgagggaggccggggatgagtttgaactgagg
A0A5F5XYW0_BCL2L1-      cagcggtgaagcaggcgctgagggaggccggggatgagtttgaactgagg
A0A5F5XYW0_BCL2L1-      cagcggtgaagcaggcgctgagggaggccggggatgagtttgaactgagg
                        ******* ** ** ************** *********************

Q8SQ42_BCL2L1-01        taccggcgggcattcagtgacctgacatcccagcttcacatcaccccagg
A0A5F5XYW0_BCL2L1-      taccggcgggcattcagcgacctgacatcccagcttcacatcaccccagg
A0A5F5XYW0_BCL2L1-      taccggcgggcattcagcgacctgacatcccagcttcacatcaccccagg
A0A5F5XYW0_BCL2L1-      taccggcgggcattcagcgacctgacatcccagcttcacatcaccccagg
                        ***************** ********************************

Q8SQ42_BCL2L1-01        gacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
A0A5F5XYW0_BCL2L1-      gacagcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
A0A5F5XYW0_BCL2L1-      gacagcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
A0A5F5XYW0_BCL2L1-      gacagcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
                        ********************************* ****************

Q8SQ42_BCL2L1-01        gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactg
A0A5F5XYW0_BCL2L1-      gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactg
A0A5F5XYW0_BCL2L1-      gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactg
A0A5F5XYW0_BCL2L1-      gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactg
                        **************************************************

Q8SQ42_BCL2L1-01        tgcgtggagagcgtagacaaggagatgcaggtattggtgagtcggatcgc
A0A5F5XYW0_BCL2L1-      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
A0A5F5XYW0_BCL2L1-      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
A0A5F5XYW0_BCL2L1-      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
                        ******** *****************************************

Q8SQ42_BCL2L1-01        agcttggatggccacttacctgaatgaccacctagagccttggatccagg
A0A5F5XYW0_BCL2L1-      aacttggatggccacttacctgaacgaccacctagagccttggatccagg
A0A5F5XYW0_BCL2L1-      aacttggatggccacttacctgaacgaccacctagagccttggatccagg
A0A5F5XYW0_BCL2L1-      aacttggatggccacttacctgaacgaccacctagagccttggatccagg
                        * ********************** *************************

Q8SQ42_BCL2L1-01        agaacggcggctgggatacttttgtggaactctacgggaacaatgcagca
A0A5F5XYW0_BCL2L1-      agaacggcggctgggttgttattgagcaccaacggtgtgcca-------g
A0A5F5XYW0_BCL2L1-      agaacggcggctgggacacttttgtggaactctacgggaacaatgcagcg
A0A5F5XYW0_BCL2L1-      agaacggcggctggg-----------------------------------
                        ***************                                   

Q8SQ42_BCL2L1-01        gccgagagccggaagggccaggagcgctccaac-----------------
A0A5F5XYW0_BCL2L1-      gctctgtgctccacagggt------gcacacagcccagaacaaagcagcc
A0A5F5XYW0_BCL2L1-      gccgagagccggaagggccaggtcagaacaaacgccgaaacagagctgcc
A0A5F5XYW0_BCL2L1-      -------tctggactggct-------------------------------
                                *   *  **                                 

Q8SQ42_BCL2L1-01        -----------------------------cgctggttcctga-----cag
A0A5F5XYW0_BCL2L1-      catggag----------------------cacctcttctagagaaaggag
A0A5F5XYW0_BCL2L1-      acagagagtttgtccggtcctggggacgacgccttgcctggatttcgctg
A0A5F5XYW0_BCL2L1-      -----------------------------tattttaccctgagttc-ctg
                                                             *  **       *

Q8SQ42_BCL2L1-01        gcatga-------------------------------------ctgtggc
A0A5F5XYW0_BCL2L1-      acacga-----------cggacaaggaaacaaacaagattgttccgggga
A0A5F5XYW0_BCL2L1-      ggacgggaagggactgttggcctggaaggtggaggaaacctcctttgggc
A0A5F5XYW0_BCL2L1-      gcacag------------ggcctg--aggttgggtaa-------------
                          *                                               

Q8SQ42_BCL2L1-01        tggcgtgg-----ttctgct--gggctcactcttcagtcggaaa------
A0A5F5XYW0_BCL2L1-      taaattg------ttctgcaaccaactacccc--------aaaacttaa-
A0A5F5XYW0_BCL2L1-      gggtctgacca--ctctgca--cagctcccgtcccagggcagaagttccc
A0A5F5XYW0_BCL2L1-      gggcttggccagcatctgct--caatgaacat---------gaggttatt
                             **       *****          *            *       

Q8SQ42_BCL2L1-01        -----------------tga
A0A5F5XYW0_BCL2L1-      ---------------gctaa
A0A5F5XYW0_BCL2L1-      ggaggagggggcggtgctga
A0A5F5XYW0_BCL2L1-      attagatgcag----gttag
                                         *  

© 1998-2022Legal notice