Dataset for CDS BCL2L1 of organism Cricetulus griseus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


B2Z3Z4_BCL2L1-01      atgtctcagagcaaccgggagctagtggttgactttctctcctacaagtt
G3HEA7_BCL2L1-01      atgtctcagagcaaccgggagctagtggttgactttctctcctacaagct
                      ************************************************ *

B2Z3Z4_BCL2L1-01      ctcccagaaaggatacagctggagtcagtttagtgatgtcgaagagaaca
G3HEA7_BCL2L1-01      ctcccagaaaggatacagctggagtcagtttagtgatgtcgaagagaaca
                      **************************************************

B2Z3Z4_BCL2L1-01      ggactgaggccccagaaggaactgaatcagagagggagacccccagtgcc
G3HEA7_BCL2L1-01      ggactgaggccccagaaggaactgaatcagagagggagacccccagtgcc
                      **************************************************

B2Z3Z4_BCL2L1-01      atcaatggcaacccatcctggcacctggcggacagccccgcggtaaatgg
G3HEA7_BCL2L1-01      atcaatggcaacccatcctggcacctggcggacagccccgcggtaaatgg
                      **************************************************

B2Z3Z4_BCL2L1-01      agccactggccacagcagcagtttggatgcacgggaggtgatccccatgg
G3HEA7_BCL2L1-01      agccactggccacagcagcagtttggatgcacgggaggtgatccccatgg
                      **************************************************

B2Z3Z4_BCL2L1-01      cagccgtaaagcaagcgctgagagaggccggcgatgagtttgagctgcgg
G3HEA7_BCL2L1-01      cagccgtaaagcaagcgctgagagaggccggcgatgagtttgagctgcgg
                      **************************************************

B2Z3Z4_BCL2L1-01      taccggcgggcgttcagtgatctaacatcccagcttcatataaccccagg
G3HEA7_BCL2L1-01      taccggcgggcgttcagtgatctaacatcccagcttcatataaccccagg
                      **************************************************

B2Z3Z4_BCL2L1-01      gactgcatatcaaagctttgaacaggtagtgaatgaactcttccgggatg
G3HEA7_BCL2L1-01      gactgcatatcaaagctttgaacaggtagtgaatgaactcttccgggatg
                      **************************************************

B2Z3Z4_BCL2L1-01      gggtaaactggggtcgcattgtggcctttttctccttcggtggagccctc
G3HEA7_BCL2L1-01      gggtaaactggggtcgcattgtggcctttttctccttcggtggagccctc
                      **************************************************

B2Z3Z4_BCL2L1-01      tgtgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
G3HEA7_BCL2L1-01      tgtgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
                      **************************************************

B2Z3Z4_BCL2L1-01      aagttggatggccacctacctgaatgaccacctagagccttggatccagg
G3HEA7_BCL2L1-01      aagttggatggccacctacctgaatgaccacctagagccttggatccagg
                      **************************************************

B2Z3Z4_BCL2L1-01      acaacggcggctgggacactttcgtggaactctacggaaacaatgcagca
G3HEA7_BCL2L1-01      acaacggcggctgggacactttcgtggaactctacggaaacaatgcagca
                      **************************************************

B2Z3Z4_BCL2L1-01      gctgagagccggaaaggccaggagcgcttcaaccgctggttcctgacggg
G3HEA7_BCL2L1-01      gctgagagccggaaaggccaggagcgcttcaaccgctggttcctgacggg
                      **************************************************

B2Z3Z4_BCL2L1-01      catgactgtggctggtgtggttctgctgggctctctcttcagtcggaagt
G3HEA7_BCL2L1-01      catgactgtggctggtgtggttctgctgggctctctcttcagtcggaagt
                      **************************************************

B2Z3Z4_BCL2L1-01      ga
G3HEA7_BCL2L1-01      ga
                      **

© 1998-2022Legal notice