Dataset for CDS MCL-1 of organism Physeter macrocephalus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A2Y9S808_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Physeter macrocephalus GN=MCL-1 (length=1056 residues).
atgttcggcctcaagagaaacgcagtaatcggactcaacctctactgtgggggggccggattgggaccgggtagcgacag
cggcgcctcccctccggggaggcggcttttggctgcgggaaaggaggccacggccgggcgagaggtagggggaggggaag
ccggcgaggtgattggcggaagcgccggcccgagccccccggccactctcgcgcccgacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccaccaggctgctgttcttcgcgcccacccgccgcgcctc
gccgcccgaagagatggaatcctcggcctccgacgccatcatgtctcccgaagaggagctggacgggtgcgagccggaac
ctctagggaagcggccggccgtcctgcctttgctggagttggtcggcgaggccagtaacagccccggcaaggacggctca
ctcccctcgacgccgcccccagcagaggaagaggaggatgagttgtaccggcagtccctggagattatctctcgatacct
ccaggagcaggcaaccggcaccaaggacgcgaagccactgggcgggtctggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggtgtgcaacggaaccacgaaacggccttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgac
tctcatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggacttcttc
catgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggc
gtatctaataagatag
>gnl|bcl2dbcds|A0A2Y9S808_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Physeter macrocephalus GN=MCL-1 (length=597 residues).
atgttcggcctcaagagaaacgcagtaatcggactcaacctctactgtgggggggccggattgggaccgggtagcgacag
cggcgcctcccctccggggaggcggcttttggcaaccggcaccaaggacgcgaagccactgggcgggtctggggccgcca
gccggaaggcgttagagaccctgcgacgggtcggggacggtgtgcaacggaaccacgaaacggccttccaaggcatgctt
cggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaac
aaactggggcaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagct
gcatcgaaccattagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgg
gatgggtttgtggacttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgc
cggagtaggagctggtttggcgtatctaataagatag
© 1998-2020Legal notice