Dataset for CDS BCL-2-like of organism Callithrix jacchus

[Download (right click)] [Edit] [Sequences] [Repertoires]

11 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F7HXW0_BCL2A1-01        atga-----------------------------------cagactctgaa
F7HXW0_BCL2A1-02        atga-----------------------------------cagactctgaa
A0A2R8MY14_BCL2-01      atgg----cgcacgctgggagaacagggtacga--taaccgggagatagt
F7CT87_BCL2L10-01       atggctgacccgctgtggcagcgcaccgagcag------------ctggt
F7GTF7_MCL1-01          atgtttggcct-ccaaagaaacgcggtaatcggactcaacctctactgtg
F7GTF7_MCL1-02          atgtttggcct-ccaaagaaacgcggtaatcggactcaacctctactgtg
F7IT36_BCL2L1-01        atgt--------c----------------tcagagcaaccgggagctggt
F7IT36_BCL2L1-02        atgt--------c----------------tcagagcaaccgggagctggt
U3CRF8_BCL2L2-01        atgg--------cgaccccagcctccgccccagacaca-cgggctctggt
U3CRF8_BCL2L2-02        atgg--------cggcggcggcggcggcggcagcagcagcgggggctgcg
U3CRF8_BCL2L2-03        atgg--------cggcggcggcggcggcggcagcagcagcgggggctgcg
                        ***                                           *   

F7HXW0_BCL2A1-01        tttggatatattc----acaatctaactcaggactatctgcagtacgtcc
F7HXW0_BCL2A1-02        tttggatatattc----acaatctaactcaggactatctgcagtacgtcc
A0A2R8MY14_BCL2-01      gatgaagtacatccactataagctgtcgcagag------gggctacgagt
F7CT87_BCL2L10-01       gacggactacctggagtactgct---cccggga------gcctggcaccc
F7GTF7_MCL1-01          ggggggccggcttgggggccggc---agcggcg------gcgccacccct
F7GTF7_MCL1-02          ggggggccggcttgggggccggc---agcggcg------gcgccacccct
F7IT36_BCL2L1-01        ggttgactttctctcctacaagctttcccagaa------aggatacagct
F7IT36_BCL2L1-02        ggttgactttctctcctacaagctttcccagaa------aggatacagct
U3CRF8_BCL2L2-01        ggcagactttgtaggttataagctgaggcagaa------aggttatgtct
U3CRF8_BCL2L2-02        ggcggtc----ggggctccgggccggggcggcg------gcgccatct-t
U3CRF8_BCL2L2-03        ggcggtc----ggggctccgggccggggcggcg------gcgccatct-t
                                                    * *                   

F7HXW0_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-02        --------------------------------------------------
A0A2R8MY14_BCL2-01      ------------------------gggatgccg-----------------
F7CT87_BCL2L10-01       ----------------------ccgagtcgcc------------------
F7GTF7_MCL1-01          ----------------------ccgggagggcggcttttggccacagaga
F7GTF7_MCL1-02          ----------------------ccgggagggcggctttt-----------
F7IT36_BCL2L1-01        --------------------------ggagtcagttt------------a
F7IT36_BCL2L1-02        --------------------------ggagtcagttt------------a
U3CRF8_BCL2L2-01        gtggaactggccccggggagggcccagcagctgaccc---gctgcaccaa
U3CRF8_BCL2L2-02        gtgcccggggccggtggggaggccggggagggggccccggggggcgcagg
U3CRF8_BCL2L2-03        gtgcccggggccggtggggaggccggggagggggccccggggggcgcagg
                                                                          

F7HXW0_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-02        --------------------------------------------------
A0A2R8MY14_BCL2-01      -------------------------gagatgtgggcgccgcgcccccagg
F7CT87_BCL2L10-01       --------------------------------------------------
F7GTF7_MCL1-01          aggaggcctcggcccagcgagaggtagggggagggga-------------
F7GTF7_MCL1-02          --------------------------------------------------
F7IT36_BCL2L1-01        gtgatgtggaagagaacagga--ctgaggccccagaa------------g
F7IT36_BCL2L1-02        gtgatgtggaagagaacagga--ctgaggccccagaa------------g
U3CRF8_BCL2L2-01        gcaatgcgggca---gctgga----gatgaattcgagacccgcttccggc
U3CRF8_BCL2L2-02        ggactacgggaacggcctggagtctgaggaactggag--------cctga
U3CRF8_BCL2L2-03        ggactacgggaacggcctggagtctgaggaactggag--------cctga
                                                                          

F7HXW0_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-02        --------------------------------------------------
A0A2R8MY14_BCL2-01      ggccgcccccgcggagggcatct--tctcttcccagcccgggcacacgcc
F7CT87_BCL2L10-01       --------------------------------------------------
F7GTF7_MCL1-01          ggccggcgcggtgactggcggaagcgccggcgctagccccccggccgccc
F7GTF7_MCL1-02          --------------------------------------------------
F7IT36_BCL2L1-01        ggactgattcggagatggagacc--------------cccagtgcca--t
F7IT36_BCL2L1-02        ggactgattcggagatggagacc--------------cccagtgcca--t
U3CRF8_BCL2L2-01        gcaccttctctgatctggcggctcagctgcatgtgaccccaggttcagcc
U3CRF8_BCL2L2-02        ggagctgct----gctggagcccgagccg-----gagcccg-----agcc
U3CRF8_BCL2L2-03        ggagctgct----gctggagcccgagccg-----gagcccg-----agcc
                                                                          

F7HXW0_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-02        --------------------------------------------------
A0A2R8MY14_BCL2-01      cggtcccgccgcgccccgggacccggtcgccaggacctcgccg-------
F7CT87_BCL2L10-01       --------------------------------------------------
F7GTF7_MCL1-01          tcacgcctgacgcccgaagggtcgtgcggccgccgcccattggcgccgag
F7GTF7_MCL1-02          --------------------------------------------------
F7IT36_BCL2L1-01        caatggcaacccatcctggcacctggcggaca------------------
F7IT36_BCL2L1-02        caatggcaacccatcctggcacctggcggaca------------------
U3CRF8_BCL2L2-01        caacaacgcttcacccaggtctccgatgaacttttccaagggg-------
U3CRF8_BCL2L2-02        tgaagaggagccgccccggcccc------gcgcccccccggga-------
U3CRF8_BCL2L2-03        tgaagaggagccgccccggcccc------gcgcccccccggga-------
                                                                          

F7HXW0_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-02        --------------------------------------------------
A0A2R8MY14_BCL2-01      -------------------------------------ccgccgcccccag
F7CT87_BCL2L10-01       --------------------------------------------------
F7GTF7_MCL1-01          gtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccac
F7GTF7_MCL1-02          --------------------------------------------------
F7IT36_BCL2L1-01        --------------------------------------------------
F7IT36_BCL2L1-02        --------------------------------------------------
U3CRF8_BCL2L2-01        -------------------------------------gtcccaactgggg
U3CRF8_BCL2L2-02        -------------------------------------gctccgg------
U3CRF8_BCL2L2-03        -------------------------------------gctccgg------
                                                                          

F7HXW0_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-02        --------------------------------------------------
A0A2R8MY14_BCL2-01      ccgccc--------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
F7GTF7_MCL1-01          ccgccgcgcggcgccgctggaggagatggaagccccggccgccgacgcca
F7GTF7_MCL1-02          --------------------------------------------------
F7IT36_BCL2L1-01        --gcccag------------------------------------------
F7IT36_BCL2L1-02        --gcccag------------------------------------------
U3CRF8_BCL2L2-01        ccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtg
U3CRF8_BCL2L2-02        --gccctg-ggcctggttcg-----ggagc--ccccggcagtcaagag--
U3CRF8_BCL2L2-03        --gccctg-ggcctggttcg-----ggagc--ccccggcagtcaagag--
                                                                          

F7HXW0_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-02        --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
F7GTF7_MCL1-01          tcatgtcgccggaagaagagctggacgggtacgagccggagcctctcggg
F7GTF7_MCL1-02          --------------------------------------------------
F7IT36_BCL2L1-01        --------------------------------------tggtgaat----
F7IT36_BCL2L1-02        --------------------------------------tggtgaat----
U3CRF8_BCL2L2-01        tcaacaaggagatggaaccactggtgggacaagtgcaggagtggat----
U3CRF8_BCL2L2-02        -----gaggaggaggagcc------gggac--------tggtcgag----
U3CRF8_BCL2L2-03        -----gaggaggaggagcc------gggac--------tggtcgag----
                                                                          

F7HXW0_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-02        --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
F7GTF7_MCL1-01          aagcggccggctgtcctgcctctgctggagttggtcggggagcctgctaa
F7GTF7_MCL1-02          --------------------------------------------------
F7IT36_BCL2L1-01        --------------------------------------------------
F7IT36_BCL2L1-02        --------------------------------------------------
U3CRF8_BCL2L2-01        --------------------------------------------------
U3CRF8_BCL2L2-02        --------------------------------------------------
U3CRF8_BCL2L2-03        --------------------------------------------------
                                                                          

F7HXW0_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-02        --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
F7GTF7_MCL1-01          tggctccagtacggacgggtcactaccgtcgacgccgccgccagcagagg
F7GTF7_MCL1-02          --------------------------------------------------
F7IT36_BCL2L1-01        --------------------------------------------------
F7IT36_BCL2L1-02        --------------------------------------------------
U3CRF8_BCL2L2-01        --------------------------------------------------
U3CRF8_BCL2L2-02        --------------------------------------------------
U3CRF8_BCL2L2-03        --------------------------------------------------
                                                                          

F7HXW0_BCL2A1-01        --------------------------------------------------
F7HXW0_BCL2A1-02        --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
F7GTF7_MCL1-01          aggaggaggacgagttgtaccggcagtcgctggagattatctctcggtac
F7GTF7_MCL1-02          --------------------------------------------------
F7IT36_BCL2L1-01        --------------------------------------------------
F7IT36_BCL2L1-02        --------------------------------------------------
U3CRF8_BCL2L2-01        --------------------------------------------------
U3CRF8_BCL2L2-02        --------------------------------------------------
U3CRF8_BCL2L2-03        --------------------------------------------------
                                                                          

F7HXW0_BCL2A1-01        --------------------tgcagataccacagt---------------
F7HXW0_BCL2A1-02        --------------------tgcagataccacagt---------------
A0A2R8MY14_BCL2-01      ----------------ccgccgccgccgccacggg---------------
F7CT87_BCL2L10-01       -----------gccgtccaccgccgaggccgctgt---------------
F7GTF7_MCL1-01          cttcgggagcaggcgaccggcgccaaggacacaaa---------------
F7GTF7_MCL1-02          -----------ggcgaccggcgccaaggacacaaa---------------
F7IT36_BCL2L1-01        -----------ggag-----c-cacgggccacagc---------------
F7IT36_BCL2L1-02        -----------ggag-----c-cacgggccacagc---------------
U3CRF8_BCL2L2-01        -----------ggtggcctac-ctggagacgcggctggccgactggatcc
U3CRF8_BCL2L2-02        -----------ggtgac---c-cgggggacggcgc---------------
U3CRF8_BCL2L2-03        -----------ggtgac---c-cgggggacggcgc---------------
                                              *      *                    

F7HXW0_BCL2A1-01        ----------------ctggaatg--------------------------
F7HXW0_BCL2A1-02        ----------------ctggaatg--------------------------
A0A2R8MY14_BCL2-01      --gcctacgctca-gcccggt-----------------------------
F7CT87_BCL2L10-01       --gc---tgcgcg---ccgtg-----------------------------
F7GTF7_MCL1-01          --gccaatgggcaggtccggg-----------------------------
F7GTF7_MCL1-02          --gccaatgggcaggtccggg-----------------------------
F7IT36_BCL2L1-01        --agcagtttggatgcccgggaggtgatccccat----------------
F7IT36_BCL2L1-02        --agcagtttggatgcccgggaggtgatccccat----------------
U3CRF8_BCL2L2-01        acagcagt---gggggctgggagctggaagctatcaaagctcgagtcagg
U3CRF8_BCL2L2-02        ----catt---gaggacccggagctggaagctatcaaagctcgagtcagg
U3CRF8_BCL2L2-03        ----catt---gaggacccggagctggaagctatcaaagctcgagtcagg
                                        *                                 

F7HXW0_BCL2A1-01        --------ggtccgagcaaaacgtctagagtgctacaacaggttgcattc
F7HXW0_BCL2A1-02        --------ggtccgagcaaaacgtctagagtgctacaacaggttgcattc
A0A2R8MY14_BCL2-01      --------gccacctgtggtccacct-----g------------------
F7CT87_BCL2L10-01       --------gccgccagtgtg-------cggaa------------------
F7GTF7_MCL1-01          --------gccgccagcaggaaggcgctggag------------------
F7GTF7_MCL1-02          --------gccgccagcaggaaggcgctggag------------------
F7IT36_BCL2L1-01        --------ggcagcag---------taaagca------------------
F7IT36_BCL2L1-02        --------ggcagcag---------taaagca------------------
U3CRF8_BCL2L2-01        gagatggaggaagaagctgagaagctaaagga------------------
U3CRF8_BCL2L2-02        gagatggaggaagaagctgagaagctaaagga------------------
U3CRF8_BCL2L2-03        gagatggaggaagaagctgagaagctaaagga------------------
                                *      *                                  

F7HXW0_BCL2A1-01        tcagtccaaaaagaagtggaa------------aagagtctgaagtcatg
F7HXW0_BCL2A1-02        tcagtccaaaaagaagtggaa------------aagagtctgaagtcatg
A0A2R8MY14_BCL2-01      --accctccgccaggccggcga------------------cgacttctcc
F7CT87_BCL2L10-01       --actctac------------------------------------cggtc
F7GTF7_MCL1-01          --accttacgacgggttggggacggcgtgcagcgcaaccacgagacggcc
F7GTF7_MCL1-02          --accttacgacgggttggggacggcgtgcagcgcaaccacgagacggcc
F7IT36_BCL2L1-01        --agcactgagggaggcagg-----cg------acgagtttga-------
F7IT36_BCL2L1-02        --agcactgagggaggcagg-----cg------acgagtttga-------
U3CRF8_BCL2L2-01        --actacagaacgaggtagagaagcag------atgaatatgagtccacc
U3CRF8_BCL2L2-02        --actacagaacgaggtagagaagcag------atgaatatgagtccacc
U3CRF8_BCL2L2-03        --actacagaacgaggtagagaagcag------atgaatatgagtccacc
                          *                                               

F7HXW0_BCL2A1-01        cttggacaatgt--tgatattgcgtccat--------------agataat
F7HXW0_BCL2A1-02        cttggacaatgt--tgatattgcgtccat--------------agataat
A0A2R8MY14_BCL2-01      cgccgctaccgccgcgacttcgccgagatgtccagccagctgca------
F7CT87_BCL2L10-01       tttcttctccgc--ctacctcggctacc-----------ccgggaaccgc
F7GTF7_MCL1-01          t---tccaaggc--atgcttcggaaactggacatcaaaaacgaagacgat
F7GTF7_MCL1-02          t---tccaaggc--atgcttcggaaactggacatcaaaaacgaagacgat
F7IT36_BCL2L1-01        -------actgc--ggtaccggcgggcattt--agtga------------
F7IT36_BCL2L1-02        -------actgc--ggtaccggcgggcattt--agtga------------
U3CRF8_BCL2L2-01        tccaggcaatgc--tggcccagtgatcatgtccattgaggagaagatgga
U3CRF8_BCL2L2-02        tccaggcaatgc--tggcccagtgatcatgtccattgaggagaagatgga
U3CRF8_BCL2L2-03        tccaggcaatgc--tggcccagtgatcatgtccattgaggagaagatgga
                                  *          *                            

F7HXW0_BCL2A1-01        gccagaacgatattcagtcaagtga-------------------------
F7HXW0_BCL2A1-02        gccagaacgatattcagtcaagtga-------------------------
A0A2R8MY14_BCL2-01      -cctgacgcccttcaccgcgcggggacgctttg----ccacggtgg----
F7CT87_BCL2L10-01       gtcgagctggtggcgaggatggcggaggccctgctctc--cgacagtccc
F7GTF7_MCL1-01          gtcaaatctttgtctcgagtgatg--gtccatgttttcagcgacgg---c
F7GTF7_MCL1-02          gtcaaatctttgtctcgagtgatg--gtccatgttttcagcgacgg---c
F7IT36_BCL2L1-01        -cctga----catccc----------agct-------ccacatcaccccc
F7IT36_BCL2L1-02        -cctga----catccc----------agct-------ccacatcaccccc
U3CRF8_BCL2L2-01        ggctgatgcccgttcc----------atctatgttggcaatgtggactat
U3CRF8_BCL2L2-02        ggctgatgcccgttcc----------atctatgttggcaatgtggactat
U3CRF8_BCL2L2-03        ggctgatgcccgttcc----------atctatgttggcaatgtggactat
                          *                                               

F7HXW0_BCL2A1-01        ---------tggaaaag----gaatttgaagat---------------gg
F7HXW0_BCL2A1-02        ---------tggaaaag----gaatttgaagat---------------gg
A0A2R8MY14_BCL2-01      ---------tggaggag----------------------ctcttcaggga
F7CT87_BCL2L10-01       ggccccacctggggcaa----cgtggtgatgctcctggccttcgcgggga
F7GTF7_MCL1-01          gtaacaaactggggtag----gattgtgactctcatttctttt-------
F7GTF7_MCL1-02          gtaacaaactggggtag----gattgtgactctcatttctttt-------
F7IT36_BCL2L1-01        gggacagcgtatcagagctttgaacaggtagtgaacgaactcttccggga
F7IT36_BCL2L1-02        gggacagcgtatcagagctttgaacaggtagtgaacgaactcttccggga
U3CRF8_BCL2L2-01        ggtgcaac--agcagaa----gagctggaagctcactttcatggctgtgg
U3CRF8_BCL2L2-02        ggtgcaac--agcagaa----gagctggaagctcactttcatggctgtgg
U3CRF8_BCL2L2-03        ggtgcaac--agcagaa----gagctggaagctcactttcatggctgtgg
                                       *                                  

F7HXW0_BCL2A1-01        cattattaactggggaagaat----tgtaaccatatt-----tgcatttg
F7HXW0_BCL2A1-02        cattattaactggggaagaat----tgtaaccatatt-----tgcatttg
A0A2R8MY14_BCL2-01      cggggtgaactgggggaggat----tgtggccttctt-----tgagttcg
F7CT87_BCL2L10-01       cgctgctagagagggggccgc---tggtgaccg---------cccggtgg
F7GTF7_MCL1-01          -------------ggtgcc-t---ttgtggcca---------aacacttg
F7GTF7_MCL1-02          -------------ggtgcc-t---ttgtggcca---------aacacttg
F7IT36_BCL2L1-01        tggggtaaactggggtcgcat----tgtggccttttt-----ctccttcg
F7IT36_BCL2L1-02        tggggtaaactggggtcgcat----tgtggccttttt-----ctccttcg
U3CRF8_BCL2L2-01        ttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatccca
U3CRF8_BCL2L2-02        ttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatccca
U3CRF8_BCL2L2-03        ttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatccca
                                     *            **  *                   

F7HXW0_BCL2A1-01        aaggtattctcatcaagaaacttcta---cgagag---------------
F7HXW0_BCL2A1-02        aaggtattctcatcaagaaacttcta---cgagag---------------
A0A2R8MY14_BCL2-01      gtggggtcatgtgtgtggagagcgtcaaccgggag---atgtcgcccctg
F7CT87_BCL2L10-01       aagaagtggggcttccag----tctcggctgaagg---------------
F7GTF7_MCL1-01          aaga----------cca-------taaaccaagaa---------------
F7GTF7_MCL1-02          aaga----------cca-------taaaccaagaa---------------
F7IT36_BCL2L1-01        gcggggcactgtgcgtggaaagcgtagacaaggag---atgcaggtattg
F7IT36_BCL2L1-02        gcggggcactgtgcgtggaaagcgtagacaaggag---atgcaggtattg
U3CRF8_BCL2L2-01        aagggtttgcatatatagagttctcagacaaagagtcagtgaggacttcc
U3CRF8_BCL2L2-02        aagggtttgcatatatagagttctcagacaaagagtcagtgaggacttcc
U3CRF8_BCL2L2-03        aagggtttgcatatatagagttctcagacaaagagtcagtgaggacttcc
                          *                                               

F7HXW0_BCL2A1-01        -----------cgaattgccccggatgtggatacttacaaggagatctca
F7HXW0_BCL2A1-02        -----------cgaattgccccggatgtggatacttacaaggagatctca
A0A2R8MY14_BCL2-01      gtg-----gacaacatcgccctgtggatgaccgagtacctgaac------
F7CT87_BCL2L10-01       --------agccggaaggcgacgtcgcccgggactgccagcgcctggtgg
F7GTF7_MCL1-01          --------agctgcattgaaccattagcagaaagtatcacagac------
F7GTF7_MCL1-02          --------agctgcattgaaccattagcagaaagtatcacagac------
F7IT36_BCL2L1-01        gtg-----agtcggatcgcagcttggatggccacttacctgaat------
F7IT36_BCL2L1-02        gtg-----agtcggatcgcagcttggatggccacttacctgaat------
U3CRF8_BCL2L2-01        ttggccttagatgagtccctatttagaggaaggcagatcaaggt------
U3CRF8_BCL2L2-02        ttggccttagatgagtccctatttagaggaaggcagatcaaggt------
U3CRF8_BCL2L2-03        ttggccttagatgagtccctatttagaggaaggcagatcaaggt------
                                                                          

F7HXW0_BCL2A1-01        cattttgttgctgagttcataatgaataacacaggagaatggataagaca
F7HXW0_BCL2A1-02        cattttgttgctgagttcataatgaataacacaggagaatggataagaca
A0A2R8MY14_BCL2-01      -----------------c-------ggcacctgcacacctggatccagga
F7CT87_BCL2L10-01       ccttgctgagttcgcggc-tcgtggggcagcaccgtgcctggctggaggc
F7GTF7_MCL1-01          ---------gtt-----c-tcgtaaggacaaaacgggactggctagttaa
F7GTF7_MCL1-02          ---------gtt-----c-tcgtaaggacaaaacgggactggctagttaa
F7IT36_BCL2L1-01        ---------gac-----c----------acctagagccttggatccagga
F7IT36_BCL2L1-02        ---------gac-----c----------acctagagccttggatccagga
U3CRF8_BCL2L2-01        ---------gat-----c-ccaaaacgaaccaacagaccaggcatcagca
U3CRF8_BCL2L2-02        ---------gat-----c-ccaaaacgaaccaacagaccaggcatcagca
U3CRF8_BCL2L2-03        ---------gat-----c-ccaaaacgaaccaacagaccaggcatcagca
                                         *                      **        

F7HXW0_BCL2A1-01        aaacggaggct-gggaaaatggctttgtaaagaagttt-------gaacc
F7HXW0_BCL2A1-02        aaacggaggctgggggaaatggc--------acagtct-------catgc
A0A2R8MY14_BCL2-01      taacggaggctggg----atgcctttgtggaactgtat--------ggcc
F7CT87_BCL2L10-01       tcagggcggctggg----atggcttttgttacttcttc-------aggac
F7GTF7_MCL1-01          acaaagaggctggg----atgggtttgtggagttcttccatgtagaggac
F7GTF7_MCL1-02          acaaagaggctggg----atgggtttgtggagttcttccatgtagaggac
F7IT36_BCL2L1-01        gaacggcggctggg----acacttttgtggaactctat-------ggaaa
F7IT36_BCL2L1-02        gaacggcggctgga----------tgaaggtgatcttt-------caaat
U3CRF8_BCL2L2-01        caaca--gaccggg---------------gttttccac-------gagcc
U3CRF8_BCL2L2-02        caaca--gaccggg---------------gttttccac-------gagcc
U3CRF8_BCL2L2-03        caaca--gaccggg---------------gttttccac-------gagcc
                          *    * *  *                                     

F7HXW0_BCL2A1-01        taaatctg------------------------------gctggatgactt
F7HXW0_BCL2A1-02        ttatgcta------------------------------gt---atcagtg
A0A2R8MY14_BCL2-01      ccagcatgcggcctctgtttgatttctcctggctgtctctgaagactctg
F7CT87_BCL2L10-01       ctcctccttg-----ctggcattatggagaaaagtgctg-----------
F7GTF7_MCL1-01          cta------g-----aaggcagaga-ttgtagtgagctgagatcgagcca
F7GTF7_MCL1-02          cta------g-----aaggtggcat-cagaaatgtgctg----ctggctt
F7IT36_BCL2L1-01        caatgcggcagccgagagccgaaagggccaggagcgcttcaaccgctggt
F7IT36_BCL2L1-02        ctcctctgca---gagatccaatggg------------------------
U3CRF8_BCL2L2-01        cgctaccgcg--cacggaccaccaactacaacagttc-ccgctctcgatt
U3CRF8_BCL2L2-02        cgctaccgcg--cacggaccaccaactacaacagttc-ccgctctcgatt
U3CRF8_BCL2L2-03        cgctaccgcg--cacggaccaccaactacaacagttc-ccgctctcgatt
                                                                          

F7HXW0_BCL2A1-01        ttctagaagttacaggaaagatctgcgaaatgctatctctcttgaagcaa
F7HXW0_BCL2A1-02        gcccagaagaagaggaaaatggctttgtaa--------------------
A0A2R8MY14_BCL2-01      ctcagcttggtcctg--gtgggagcttgcatcaccctgggtgcct----a
F7CT87_BCL2L10-01       gtccaggttttcctgtcatggttgttaacagcagtattcat--ct---ac
F7GTF7_MCL1-01          ttgta-----ctccagcccaggggatggtacgagactttgt--ctcaaaa
F7GTF7_MCL1-02          ttgcgggtgttgctggagtaggagctgggttggca---tat--ct-----
F7IT36_BCL2L1-01        tcctgacgggcatgactgtggccggcgtggt---------t--ct----g
F7IT36_BCL2L1-02        -----------ataatggtgactacca-------------t--tt----a
U3CRF8_BCL2L2-01        ctacagtggttttaacagcaggccccggggtcg-----cgt--ct----a
U3CRF8_BCL2L2-02        ctacagtggttttaacagcaggccccggggtcg-----cgt--ct----a
U3CRF8_BCL2L2-03        ctacagtggttttaacagcaggccccggggtcg-----cgt--ct----a
                                                                          

F7HXW0_BCL2A1-01        tactgttga------------------------------------
F7HXW0_BCL2A1-02        ---------------------------------------------
A0A2R8MY14_BCL2-01      tctgggccacaagtga-----------------------------
F7CT87_BCL2L10-01       ttctggaca--cgataa----------------------------
F7GTF7_MCL1-01          aaaaaaaaa--agttaa----------------------------
F7GTF7_MCL1-02          -----aata--agatag----------------------------
F7IT36_BCL2L1-01        ctgggctcactctttagtcggaaatga------------------
F7IT36_BCL2L1-02        ttgagc-----atctag----------------------------
U3CRF8_BCL2L2-01        caggggccg--ggctagagcgacatcatggtattccccttactaa
U3CRF8_BCL2L2-02        caggggccg--ggctagagcgacatcatggtattccccttactaa
U3CRF8_BCL2L2-03        ca--ggtca--ggatag----------------------------
                                                                     

© 1998-2022Legal notice