Dataset for CDS BCL-2-like of organism Callithrix jacchus

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F7HXW0_BCL2A1-01        atgacagactctgaatttggata---------tattcacaatctaactca
A0A2R8M4C0_BCL2L2-      atggcgaccccagcctccgcccc-----aga-cacacgggctctggtggc
F7IT34_BCL2L1-01        at----------------gtctc-----agagcaaccgggagctggtggt
A0A2R8MY14_BCL2-01      atggc--gcac-gctgggagaacagggtacgataaccgggagatagtgat
F7CT87_BCL2L10-01       atggctgaccc-gctgcggcagc-----gcaccgagcag-----------
F7GTF7_MCL1-01          atgtttggcct--ccaaagaaac-----gcggtaatcgg-----------
F7GTF7_MCL1-02          atgtttggcct--ccaaagaaac-----gcggtaatcgg-----------
                        **                                  *             

F7HXW0_BCL2A1-01        ggactatctgcagtacgtcctgc-----agataccac-------------
A0A2R8M4C0_BCL2L2-      agactttgtaggttataagctgaggcagaaaggttatgtctg--------
F7IT34_BCL2L1-01        tgactttctctcctacaagctttcccagaaaggatacagctggagtcagt
A0A2R8MY14_BCL2-01      gaagtacatccactataagctgtcgcagaggggctacgagtgg-------
F7CT87_BCL2L10-01       -------------------ctgg---tgacggactac--ctgg-------
F7GTF7_MCL1-01          -------actcaacctctactgt---gggggggccgg--cttg-------
F7GTF7_MCL1-02          -------actcaacctctactgt---gggggggccgg--cttg-------
                                           **                             

F7HXW0_BCL2A1-01        -----agtctggaatgggtccgagcaaaacgtcta--------------g
A0A2R8M4C0_BCL2L2-      -------------------tggaact--ggccccg--------------g
F7IT34_BCL2L1-01        ttagtgatgtggaagagaacaggactgaggcccca--------------g
A0A2R8MY14_BCL2-01      -----gatgccggagatgtgggcgccgcgcccccaggggccgcccccgcg
F7CT87_BCL2L10-01       -----agtactgctcccgggagcctggcacccccg--------------a
F7GTF7_MCL1-01          -----ggggccggcagcggcggcgccacccctccg--------------g
F7GTF7_MCL1-02          -----ggggccggcagcggcggcgccacccctccg--------------g
                                             *          *                 

F7HXW0_BCL2A1-01        agtgct--------------------------------------------
A0A2R8M4C0_BCL2L2-      ggagg---------------------------------------------
F7IT34_BCL2L1-01        aaggga--------------------------------------------
A0A2R8MY14_BCL2-01      gagggcatcttctcttcccagcccg-------------------------
F7CT87_BCL2L10-01       gtcgcc--------------------------------------------
F7GTF7_MCL1-01          gagggcggcttttggccacagagaaggaggcctcggcccagcgagaggta
F7GTF7_MCL1-02          gagggcggctttt-------------------------------------
                           *                                              

F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
F7GTF7_MCL1-01          gggggaggggaggccggcgcggtgactggcggaagcgccggcgctagccc
F7GTF7_MCL1-02          --------------------------------------------------
                                                                          

F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
F7IT34_BCL2L1-01        -----------------ctgattcggagatggagacccccagtgccatca
A0A2R8MY14_BCL2-01      --------------------------------------ggcacacgcccg
F7CT87_BCL2L10-01       --------------------------------------------------
F7GTF7_MCL1-01          cccggccgccctcacgcctgacgcccgaagggtcgtgcggccgccgccca
F7GTF7_MCL1-02          --------------------------------------------------
                                                                          

F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
F7IT34_BCL2L1-01        atggcaacccatcctggcacctggcggacagcccagtggtgaat------
A0A2R8MY14_BCL2-01      gtcccgccgcgccccgggacccggtcgccaggacctcgccgccgccgccc
F7CT87_BCL2L10-01       --------------------------------------------------
F7GTF7_MCL1-01          ttggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttc
F7GTF7_MCL1-02          --------------------------------------------------
                                                                          

F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
A0A2R8MY14_BCL2-01      ccagc---------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
F7GTF7_MCL1-01          ttcgcgcccacccgccgcgcggcgccgctggaggagatggaagccccggc
F7GTF7_MCL1-02          --------------------------------------------------
                                                                          

F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
F7GTF7_MCL1-01          cgccgacgccatcatgtcgccggaagaagagctggacgggtacgagccgg
F7GTF7_MCL1-02          --------------------------------------------------
                                                                          

F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
F7GTF7_MCL1-01          agcctctcgggaagcggccggctgtcctgcctctgctggagttggtcggg
F7GTF7_MCL1-02          --------------------------------------------------
                                                                          

F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
F7GTF7_MCL1-01          gagcctgctaatggctccagtacggacgggtcactaccgtcgacgccgcc
F7GTF7_MCL1-02          --------------------------------------------------
                                                                          

F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
F7GTF7_MCL1-01          gccagcagaggaggaggaggacgagttgtaccggcagtcgctggagatta
F7GTF7_MCL1-02          --------------------------------------------------
                                                                          

F7HXW0_BCL2A1-01        --------------------------------------acaacaggttgc
A0A2R8M4C0_BCL2L2-      --------------------------------------------------
F7IT34_BCL2L1-01        ----------------------ggagccacgggccacagcagcagtttgg
A0A2R8MY14_BCL2-01      ----------------------cgcccccgccgccgccgccacggggcct
F7CT87_BCL2L10-01       ----------------------gccgtccaccgccgaggccgctgtgc--
F7GTF7_MCL1-01          tctctcggtaccttcgggagcaggcgaccggcgccaaggacacaaagcca
F7GTF7_MCL1-02          ----------------------ggcgaccggcgccaaggacacaaagcca
                                                                          

F7HXW0_BCL2A1-01        attctca-----------gtccaaaaagaagtggaaaagagtctgaagtc
A0A2R8M4C0_BCL2L2-      --gccca-gcagctgacccgc----------tgcaccaagcaatgcgggc
F7IT34_BCL2L1-01        atgcccg-ggaggtgatccccatggcagcagtaaagcaagcactgaggga
A0A2R8MY14_BCL2-01      acgctca-gcccggtgccacctgtggtccacct-----gaccctccgcca
F7CT87_BCL2L10-01       -tgcgcg---ccgtggccgccagtgtg-------cggaaactctac----
F7GTF7_MCL1-01          atgggcaggtccggggccgccagcaggaaggcgctggagaccttacgacg
F7GTF7_MCL1-02          atgggcaggtccggggccgccagcaggaaggcgctggagaccttacgacg
                             *              *                      *      

F7HXW0_BCL2A1-01        atgcttggacaatgttgata------------ttgcgt------------
A0A2R8M4C0_BCL2L2-      agctggagatgaattcgagacccgcttc----cggcgcaccttctctgat
F7IT34_BCL2L1-01        ggcaggcgacgagtttgaactgcggtac----cggcgggcatttagtgac
A0A2R8MY14_BCL2-01      ggccggcgacgacttctcccgccgctac----cgccgcgacttcgccgag
F7CT87_BCL2L10-01       --------------------------------cggtctttcttctccgcc
F7GTF7_MCL1-01          ggttggggacggcgtgcagcgcaaccacgagacggcct---tccaaggca
F7GTF7_MCL1-02          ggttggggacggcgtgcagcgcaaccacgagacggcct---tccaaggca
                                                                          

F7HXW0_BCL2A1-01        ------------------------ccatagataatgccagaacgatattc
A0A2R8M4C0_BCL2L2-      ctggcggctcagctgcatgtgaccccaggttcagcccaacaacg--cttc
F7IT34_BCL2L1-01        ctgacatcccagctccacatcacccccgggacagcgtatcagag--cttt
A0A2R8MY14_BCL2-01      atgtccagccagctgcacctgacgcccttcaccgcgcggggacg--cttt
F7CT87_BCL2L10-01       tacctcggctacc-----------ccgggaaccgcgtcgagctg---gtg
F7GTF7_MCL1-01          tgcttcggaaactggacatcaaaaacgaagacgatgtcaaatct---ttg
F7GTF7_MCL1-02          tgcttcggaaactggacatcaaaaacgaagacgatgtcaaatct---ttg
                                                 *                      * 

F7HXW0_BCL2A1-01        agtcaagtgatggaaaagga--atttgaagatgg---cattattaactgg
A0A2R8M4C0_BCL2L2-      acccaggtctccgatgaact--tttccaaggggg------tcccaactgg
F7IT34_BCL2L1-01        gaacaggtagtgaacgaact--cttccgggatgg------ggtaaactgg
A0A2R8MY14_BCL2-01      gccacggtggtggaggagct--cttcagggacgg------ggtgaactgg
F7CT87_BCL2L10-01       gcgaggatggcggaggccctgctctc--cgacagtcccggccccacctgg
F7GTF7_MCL1-01          tctcgagtgatg--gtccatgttttcagcgacgg---cgtaacaaactgg
F7GTF7_MCL1-02          tctcgagtgatg--gtccatgttttcagcgacgg---cgtaacaaactgg
                               *                *    *   *          * ****

F7HXW0_BCL2A1-01        ggaagaattgtaaccatatttgcattt-----------------gaaggt
A0A2R8M4C0_BCL2L2-      ggccgccttgtagccttctttgtcttt-----------------ggggct
F7IT34_BCL2L1-01        ggtcgcattgtggcctttttctccttc-----------------ggcggg
A0A2R8MY14_BCL2-01      gggaggattgtggccttctttgagttc-----------------ggtggg
F7CT87_BCL2L10-01       ggcaacgtggtgatgctcctggccttcgcggggacgctgctagagagggg
F7GTF7_MCL1-01          ggtaggattgtgactctcatttctttt--------------------ggt
F7GTF7_MCL1-02          ggtaggattgtgactctcatttctttt--------------------ggt
                        **     * **     *  *    **                     *  

F7HXW0_BCL2A1-01        attctca-------------tcaaga------------------------
A0A2R8M4C0_BCL2L2-      gcactgtgtg----------ctgaga-------------gtgtcaacaag
F7IT34_BCL2L1-01        gcactgtgcg----------tggaaa-------------gcgtagacaag
A0A2R8MY14_BCL2-01      gtcatgtgtg----------tggaga-------------gcgtcaaccgg
F7CT87_BCL2L10-01       gccgctggtgaccgcccggtggaagaagtggggcttccagtctcggctga
F7GTF7_MCL1-01          gcc-tttgtggccaaacacttgaaga----------cca---taaaccaa
F7GTF7_MCL1-02          gcc-tttgtggccaaacacttgaaga----------cca---taaaccaa
                                               * *                        

F7HXW0_BCL2A1-01        -------aacttctacgagagcgaattgccccggatgtggatacttacaa
A0A2R8M4C0_BCL2L2-      gagatggaaccactggtgggacaagtgcaggagtggatggtggcctacct
F7IT34_BCL2L1-01        gagatgcaggtattggtgagtcggatcgcagcttggatggccacttacct
A0A2R8MY14_BCL2-01      gagatgtcgcccctggtggacaacatcgccctgtggatgaccgagtacct
F7CT87_BCL2L10-01       aggag-------ccggaaggcgacgtcgcccgg---------gactgcca
F7GTF7_MCL1-01          gaaag-------ctgcattgaaccattagcaga---------aagtatca
F7GTF7_MCL1-02          gaaag-------ctgcattgaaccattagcaga---------aagtatca
                                                 *                   *    

F7HXW0_BCL2A1-01        ggagatctcacattttgttgctgagttcataatgaataacacaggagaat
A0A2R8M4C0_BCL2L2-      ggaga------------------------------cgcggctggccgact
F7IT34_BCL2L1-01        gaatg------------------------------accacctagagcctt
A0A2R8MY14_BCL2-01      gaacc------------------------------ggcacctgcacacct
F7CT87_BCL2L10-01       gcgcctggtggccttgctgagttcgcggctcgtggggcagcaccgtgcct
F7GTF7_MCL1-01          cagac---------------gtt-----ctcgtaaggacaaaacgggact
F7GTF7_MCL1-02          cagac---------------gtt-----ctcgtaaggacaaaacgggact
                                                                         *

F7HXW0_BCL2A1-01        ggataagacaaaacggaggctgggg-------------------------
A0A2R8M4C0_BCL2L2-      ggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtc
F7IT34_BCL2L1-01        ggatccaggagaacggcggctggga-------------------------
A0A2R8MY14_BCL2-01      ggatccaggataacggaggctggga-------------------------
F7CT87_BCL2L10-01       ggctggaggctcagggcggctggga-------------------------
F7GTF7_MCL1-01          ggctagttaaacaaagaggctggga-------------------------
F7GTF7_MCL1-02          ggctagttaaacaaagaggctggga-------------------------
                        ** *           * *******                          

F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2R8M4C0_BCL2L2-      agggagatggaggaagaagctgagaagctaaaggaactacagaacgaggt
F7IT34_BCL2L1-01        --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
F7GTF7_MCL1-01          --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
                                                                          

F7HXW0_BCL2A1-01        --------------------------------gaaat-------------
A0A2R8M4C0_BCL2L2-      agagaagcagatgaatatgagtccacctccaggcaatgctggcccagtga
F7IT34_BCL2L1-01        -----------------------cacttttgtggaac-------------
A0A2R8MY14_BCL2-01      -----------------------tgcctttgtggaac-------------
F7CT87_BCL2L10-01       -----------------------tggcttttgttact-------------
F7GTF7_MCL1-01          -----------------------tgggtttgtggagt-------------
F7GTF7_MCL1-02          -----------------------tgggtttgtggagt-------------
                                                          *               

F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2R8M4C0_BCL2L2-      tcatgtccattgaggagaagatggaggctgatgcccgttccatctatgtt
F7IT34_BCL2L1-01        ------------------------------------------tctatgga
A0A2R8MY14_BCL2-01      -------tgtatggccccagcatgcggcctctgtttgatttctcctggct
F7CT87_BCL2L10-01       -------tct----tc-------aggacctc----------ctccttgct
F7GTF7_MCL1-01          -------tct----tccatgtagaggaccta----------gaa---ggt
F7GTF7_MCL1-02          -------tct----tccatgtagaggaccta----------gaa---ggt
                                                                          

F7HXW0_BCL2A1-01        --------------------------------------ggcacagtctca
A0A2R8M4C0_BCL2L2-      ggcaatgtggactatggtgcaacagcagaagagctggaagctcactttca
F7IT34_BCL2L1-01        aacaatgcgg------------cagccg-agagccgaaag----------
A0A2R8MY14_BCL2-01      gtctct---g----------------aagactctgctcagcttggtcctg
F7CT87_BCL2L10-01       ggcattatgg----------------agaaaagtgctggtccaggttttc
F7GTF7_MCL1-01          ggcatc--------------------agaaatgtgctg--ctggcttttg
F7GTF7_MCL1-02          ggcatc--------------------agaaatgtgctg--ctggcttttg
                                                                          

F7HXW0_BCL2A1-01        tgcttatgctagtatcagtggc----------------------------
A0A2R8M4C0_BCL2L2-      tggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtg
F7IT34_BCL2L1-01        -ggccaggagcgcttcaaccgc--------------------------tg
A0A2R8MY14_BCL2-01      gtgg-gagcttgcatcacc--c----------------------------
F7CT87_BCL2L10-01       ctgtcatggttg--ttaacagc----------------------------
F7GTF7_MCL1-01          cgggtgttgctggagtaggagc----------------------------
F7GTF7_MCL1-02          cgggtgttgctggagtaggagc----------------------------
                                        *                                 

F7HXW0_BCL2A1-01        -----ccagaagaagaggaaaat---------------------------
A0A2R8M4C0_BCL2L2-      gccatcccaaagggtttgcatatatagagttctcagacaaagagtcagtg
F7IT34_BCL2L1-01        gt--tcctgacgggcatgactgt-------------------ggccggcg
A0A2R8MY14_BCL2-01      ----------tgggt--gcctat---------------------------
F7CT87_BCL2L10-01       ----------agtattcatctac---------------------------
F7GTF7_MCL1-01          ----------tgggttggcatat---------------------------
F7GTF7_MCL1-02          ----------tgggttggcatat---------------------------
                                   *                                      

F7HXW0_BCL2A1-01        ------ggctttgt------------------------------------
A0A2R8M4C0_BCL2L2-      aggacttccttggccttagatgagtccctatttagaggaaggcagatcaa
F7IT34_BCL2L1-01        tggttctgctgggc----------tcactctttag---------------
A0A2R8MY14_BCL2-01      --------ctgggc------------------------------------
F7CT87_BCL2L10-01       --------ttctgg------------------------------------
F7GTF7_MCL1-01          --------ct---a------------------------------------
F7GTF7_MCL1-02          --------ct---a------------------------------------
                                 *                                        

F7HXW0_BCL2A1-01        --------------aa----------------------------------
A0A2R8M4C0_BCL2L2-      ggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggg
F7IT34_BCL2L1-01        ------tcggaaatga----------------------------------
A0A2R8MY14_BCL2-01      -------cacaagtga----------------------------------
F7CT87_BCL2L10-01       -------acacgataa----------------------------------
F7GTF7_MCL1-01          -------ataagatag----------------------------------
F7GTF7_MCL1-02          -------ataagatag----------------------------------
                                                                          

F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2R8M4C0_BCL2L2-      gttttccacgagcccgctaccgcgcacggaccaccaactacaacagttcc
F7IT34_BCL2L1-01        --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
F7GTF7_MCL1-01          --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
                                                                          

F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2R8M4C0_BCL2L2-      cgctctcgattctacagtggttttaacagcaggccccggggtcgcgtcta
F7IT34_BCL2L1-01        --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
F7GTF7_MCL1-01          --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
                                                                          

F7HXW0_BCL2A1-01        -------------------------------------------
A0A2R8M4C0_BCL2L2-      caggggccgggctagagcgacatcatggtattccccttactaa
F7IT34_BCL2L1-01        -------------------------------------------
A0A2R8MY14_BCL2-01      -------------------------------------------
F7CT87_BCL2L10-01       -------------------------------------------
F7GTF7_MCL1-01          -------------------------------------------
F7GTF7_MCL1-02          -------------------------------------------
                                                                   

© 1998-2020Legal notice