Dataset for CDS BCL-2-like of organism Callithrix jacchus

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F7HXW0_BCL2A1-01        atgacagactc------------tgaatttggatatattcacaatctaac
A0A2R8MY14_BCL2-01      atgg----cgcacgctgggagaacagggtacga--taaccgggagatagt
F7GTF7_MCL1-01          atgtttggcct-ccaaagaaacgcggtaatcggactcaacctctactgtg
F7GTF7_MCL1-02          atgtttggcct-ccaaagaaacgcggtaatcggactcaacctctactgtg
A0A5F4WGS2_BCL2L10      atggctgacccgctgcg---------------g------------gtggt
F7CT87_BCL2L10-01       atggctgacccgctgcggcagcgcaccgagcag------------ctggt
F7IT36_BCL2L1-01        atgt--------c----------------tcagagcaaccgggagctggt
U3CRF8_BCL2L2-01        atgg--------cgaccccagcctccgccccagacaca-cgggctctggt
U3CRF8_BCL2L2-02        atgg--------cggcggcggcggcggcggcagcagcagcgggggctgcg
                        ***                                           *   

F7HXW0_BCL2A1-01        tcaggactatctgcagtacgtcct---gcagataccaca-gtct------
A0A2R8MY14_BCL2-01      gatgaagtacatccactataagctgtcgcagaggggctacgagt------
F7GTF7_MCL1-01          ggggggccggcttgggggccggca---gcggcggcgccacccct------
F7GTF7_MCL1-02          ggggggccggcttgggggccggca---gcggcggcgccacccct------
A0A5F4WGS2_BCL2L10      ggctgactacctggagtgctgctt---ccgggagcccggcaccc------
F7CT87_BCL2L10-01       gacggactacctggagtactgctc---ccgggagcctggcaccc------
F7IT36_BCL2L1-01        ggttgactttctctcctacaagctttcccagaaaggatacagct------
U3CRF8_BCL2L2-01        ggcagactttgtaggttataagctgaggcagaaaggttatgtctgtggaa
U3CRF8_BCL2L2-02        ggcggtc----ggggctccgggccggggcggcggcgccatct-tgtgccc
                                                    * *                   

F7HXW0_BCL2A1-01        --------------------ggaatgggtccga-----------------
A0A2R8MY14_BCL2-01      ---------gggatgccggagatgtgggcgccgcgcc-------------
F7GTF7_MCL1-01          ----------------ccgggagggcggcttttggccacagagaaggagg
F7GTF7_MCL1-02          ----------------ccgggagggcggctttt-----------------
A0A5F4WGS2_BCL2L10      ----------------ccgagtcgccgccgtcc-----------------
F7CT87_BCL2L10-01       ----------------ccgagtcgccgccgtcc-----------------
F7IT36_BCL2L1-01        --------------------ggagtcagttt-------------------
U3CRF8_BCL2L2-01        ctggccccggggagggcccagcagctgaccc-------------------
U3CRF8_BCL2L2-02        ggggccggtggggaggccggggagggggccccg-----------------
                                            *                             

F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
F7GTF7_MCL1-01          cctcggcccagcgagaggtagggggaggggaggccggcgcggtgactggc
F7GTF7_MCL1-02          --------------------------------------------------
A0A5F4WGS2_BCL2L10      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
F7IT36_BCL2L1-01        --------------------------------------------------
U3CRF8_BCL2L2-01        --------------------------------------------------
U3CRF8_BCL2L2-02        --------------------------------------------------
                                                                          

F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
F7GTF7_MCL1-01          ggaagcgccggcgctagccccccggccgccctcacgcctgacgcccgaag
F7GTF7_MCL1-02          --------------------------------------------------
A0A5F4WGS2_BCL2L10      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
F7IT36_BCL2L1-01        --------------------------------------------------
U3CRF8_BCL2L2-01        --------------------------------------------------
U3CRF8_BCL2L2-02        --------------------------------------------------
                                                                          

F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------cccaggggccgc
F7GTF7_MCL1-01          ggtcgtgcggccgccgcccattggcgccgaggtccccgacgtcaccgcga
F7GTF7_MCL1-02          --------------------------------------------------
A0A5F4WGS2_BCL2L10      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
F7IT36_BCL2L1-01        ----------------------agtgatgtggaagagaacagga--ctga
U3CRF8_BCL2L2-01        -------------gctgcaccaagcaatgcgggca---gctgga----ga
U3CRF8_BCL2L2-02        ------------gggggcgcaggggactacgggaacggcctggagtctga
                                                                          

F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2R8MY14_BCL2-01      ccccgcggagggcatcttctcttcccagccc-------------------
F7GTF7_MCL1-01          ccccctcgagg----ctgctgttcttcgcgcccacccgccgcgcggcgcc
F7GTF7_MCL1-02          --------------------------------------------------
A0A5F4WGS2_BCL2L10      -acggccgagg----ccgctgtgctgcgcgc-------------------
F7CT87_BCL2L10-01       -accgccgagg----ccgctgtgctgcgcgc-------------------
F7IT36_BCL2L1-01        ggccccagaa----------------gggac-------------------
U3CRF8_BCL2L2-01        tgaattcgaga----cccgcttccggcgcac-------------------
U3CRF8_BCL2L2-02        ggaactggag------------cctgaggag-------------------
                                                                          

F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
F7GTF7_MCL1-01          gctggaggagatggaagccccggccgccgacgccatcatgtcgccggaag
F7GTF7_MCL1-02          --------------------------------------------------
A0A5F4WGS2_BCL2L10      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
F7IT36_BCL2L1-01        --------------------------------------------------
U3CRF8_BCL2L2-01        --------------------------------------------------
U3CRF8_BCL2L2-02        --------------------------------------------------
                                                                          

F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2R8MY14_BCL2-01      --------------------------------------------------
F7GTF7_MCL1-01          aagagctggacgggtacgagccggagcctctcgggaagcggccggctgtc
F7GTF7_MCL1-02          --------------------------------------------------
A0A5F4WGS2_BCL2L10      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
F7IT36_BCL2L1-01        --------------------------------------------------
U3CRF8_BCL2L2-01        --------------------------------------------------
U3CRF8_BCL2L2-02        --------------------------------------------------
                                                                          

F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2R8MY14_BCL2-01      -----------------------------------gggcacacgcccggt
F7GTF7_MCL1-01          ctgcctctgctggagttggtcggggagcctgctaatggctccagtacgga
F7GTF7_MCL1-02          --------------------------------------------------
A0A5F4WGS2_BCL2L10      --------------------------------------------------
F7CT87_BCL2L10-01       --------------------------------------------------
F7IT36_BCL2L1-01        -----------------------------------tgattcggagatgga
U3CRF8_BCL2L2-01        -----------------------------------cttctctgatctggc
U3CRF8_BCL2L2-02        -----------------------------------ctgct----gctgga
                                                                          

F7HXW0_BCL2A1-01        --------------------------------------------gcaaaa
A0A2R8MY14_BCL2-01      cccgccgcgccccgggacccggtcgccaggacctcg-------------c
F7GTF7_MCL1-01          cgggtcactaccgtcgacgccgccgccagcagaggaggaggaggacgagt
F7GTF7_MCL1-02          --------------------------------------------------
A0A5F4WGS2_BCL2L10      -----------------catggccgccggtgtacgg----------aaac
F7CT87_BCL2L10-01       -----------------cgtggccgccagtgtgcgg----------aaac
F7IT36_BCL2L1-01        gacc--------------cccagtgcca--tcaatg--------gcaacc
U3CRF8_BCL2L2-01        ggctcagctgcatgtgaccccaggttcagcccaaca--------acgctt
U3CRF8_BCL2L2-02        gcccgagccg-----gagcccg-----agcctgaag--------aggagc
                                                                          

F7HXW0_BCL2A1-01        cgtctagagtgctac--------------------------------aac
A0A2R8MY14_BCL2-01      cgccgccgcccccag--------------------------------ccg
F7GTF7_MCL1-01          tgtaccggcagtcgctggagattat----------------------ctc
F7GTF7_MCL1-02          --------------------------------------------------
A0A5F4WGS2_BCL2L10      tgtaccggtcct---------tctt----------------------ctc
F7CT87_BCL2L10-01       tctaccggtctt---------tctt----------------------ctc
F7IT36_BCL2L1-01        catcctggcacctggcggaca--------------------------gcc
U3CRF8_BCL2L2-01        cacccaggtctccgatgaacttttccaagggggtcccaactggggccgcc
U3CRF8_BCL2L2-02        cgccccggcccc------gcgcccccccgggagctccgg--------gcc
                                                                          

F7HXW0_BCL2A1-01        aggttgcattctcagtccaaaaag--------------------------
A0A2R8MY14_BCL2-01      cccccgccgccgccgccacggggcctacgct-------------------
F7GTF7_MCL1-01          tcggtaccttcgggagcaggcgaccggcgccaaggacacaaagc------
F7GTF7_MCL1-02          ------------------ggcgaccggcgccaaggacacaaagc------
A0A5F4WGS2_BCL2L10      cgcctacctcctctaccccgggaaccgcggc---------gagc------
F7CT87_BCL2L10-01       cgcctacctcggctaccccgggaaccgcgtc---------gagc------
F7IT36_BCL2L1-01        cag-----------------------------------------------
U3CRF8_BCL2L2-01        ttgtagccttctttgtctttggggctgcactgtgtgctgagagtgtcaac
U3CRF8_BCL2L2-02        ctg-ggcctggttcg-----ggagc--ccccggcagtcaagag-------
                                                                          

F7HXW0_BCL2A1-01        ---------------------------------aagtggaaaagag----
A0A2R8MY14_BCL2-01      ---------------------------------cag--------------
F7GTF7_MCL1-01          ---------------------------------caatgggcagg------
F7GTF7_MCL1-02          ---------------------------------caatgggcagg------
A0A5F4WGS2_BCL2L10      ---------------------------------tggtgg-----------
F7CT87_BCL2L10-01       ---------------------------------tggtgg-----------
F7IT36_BCL2L1-01        ---------------------------------tggtgaatggag-----
U3CRF8_BCL2L2-01        aaggagatggaaccactggtgggacaagtgcaggagtggatggtggccta
U3CRF8_BCL2L2-02        gaggaggaggagcc------gggac--------tggtcgagggtgac---
                                                                          

F7HXW0_BCL2A1-01        tctgaagtcatgct------------------------------------
A0A2R8MY14_BCL2-01      cccggtgccac----------------------ctgt-----------gg
F7GTF7_MCL1-01          tccggggccgc----------------------cagcaggaa------gg
F7GTF7_MCL1-02          tccggggccgc----------------------cagcaggaa------gg
A0A5F4WGS2_BCL2L10      --cgaggatgg----------------------c-----gga------gg
F7CT87_BCL2L10-01       --cgaggatgg----------------------c-----gga------gg
F7IT36_BCL2L1-01        ccacgggccacagc-----------------agcagtttggatgcccggg
U3CRF8_BCL2L2-01        cctggagacgcggctggccgactggatccacagcagtggggg---ctggg
U3CRF8_BCL2L2-02        ccgggggacggcgc-------------------cattgagga---cccgg
                              *                                           

F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2R8MY14_BCL2-01      tccacctgaccct-------------------------------------
F7GTF7_MCL1-01          cgctggagacctt-------------------------------------
F7GTF7_MCL1-02          cgctggagacctt-------------------------------------
A0A5F4WGS2_BCL2L10      ccctg----ctct-------------------------------------
F7CT87_BCL2L10-01       ccctg----ctct-------------------------------------
F7IT36_BCL2L1-01        aggtgatccccat------------------------ggcagcag-----
U3CRF8_BCL2L2-01        agctggaagctatcaaagctcgagtcagggagatggaggaagaagctgag
U3CRF8_BCL2L2-02        agctggaagctatcaaagctcgagtcagggagatggaggaagaagctgag
                                                                          

F7HXW0_BCL2A1-01        ---------------------------------tggacaatgttgatatt
A0A2R8MY14_BCL2-01      ---------------------------------ccgccaggccggcgacg
F7GTF7_MCL1-01          ---------------------------------acgacgggttggggacg
F7GTF7_MCL1-02          ---------------------------------acgacgggttggggacg
A0A5F4WGS2_BCL2L10      ---------------------------------ccgacagtcccggcccc
F7CT87_BCL2L10-01       ---------------------------------ccgacagtcccggcccc
F7IT36_BCL2L1-01        ----taaagcaagcactgagggaggcagg-----cgacgagtttga----
U3CRF8_BCL2L2-01        aagctaaaggaactacagaacgaggtagagaagcagatgaatatgagtcc
U3CRF8_BCL2L2-02        aagctaaaggaactacagaacgaggtagagaagcagatgaatatgagtcc
                                                           *        *     

F7HXW0_BCL2A1-01        gcgtccatagataatgccagaacgatattca-------------------
A0A2R8MY14_BCL2-01      acttctcccgccgctaccgccgcga----------cttcgccgagatgtc
F7GTF7_MCL1-01          gcgtgcagcg-caaccacga---ga------cggccttccaaggcatgc-
F7GTF7_MCL1-02          gcgtgcagcg-caaccacga---ga------cggccttccaaggcatgc-
A0A5F4WGS2_BCL2L10      acctg--ggg-caacgtggt---gatgctcctggccttcgcagggacgc-
F7CT87_BCL2L10-01       acctg--ggg-caacgtggt---gatgctcctggccttcgcggggacgc-
F7IT36_BCL2L1-01        ------------actgcggtaccggcgggcattt--agtga---------
U3CRF8_BCL2L2-01        acctcc-agg-caatgctggcccagtgatcatgtccattgaggagaaga-
U3CRF8_BCL2L2-02        acctcc-agg-caatgctggcccagtgatcatgtccattgaggagaaga-
                                                                          

F7HXW0_BCL2A1-01        --------------------------------------------------
A0A2R8MY14_BCL2-01      cagccagctgcacctgacgcccttcaccgcg----------cggggacgc
F7GTF7_MCL1-01          -------tt------------cggaaactggacatcaaaaacgaagacga
F7GTF7_MCL1-02          -------tt------------cggaaactggacatcaaaaacgaagacga
A0A5F4WGS2_BCL2L10      -------tg------------c-------------tagagagggggccgc
F7CT87_BCL2L10-01       -------tg------------c-------------tagagagggggccgc
F7IT36_BCL2L1-01        ------------cctga----catcccagct-------ccacatcacccc
U3CRF8_BCL2L2-01        -------tggaggctgatgcccgttccatctatgttggcaatgtggacta
U3CRF8_BCL2L2-02        -------tggaggctgatgcccgttccatctatgttggcaatgtggacta
                                                                          

F7HXW0_BCL2A1-01        --------------------gtcaagtgatggaaaaggaatttgaagatg
A0A2R8MY14_BCL2-01      t-------------------ttgccacggtggtggaggagctcttcaggg
F7GTF7_MCL1-01          tgtca------aatctttgtctcgagtgatggtccatgttttcagcgacg
F7GTF7_MCL1-02          tgtca------aatctttgtctcgagtgatggtccatgttttcagcgacg
A0A5F4WGS2_BCL2L10      tggtg------accgcccggtggaagaagtgg----ggcttccggtcgtg
F7CT87_BCL2L10-01       tggtg------accgcccggtggaagaagtgg----ggcttccagtctcg
F7IT36_BCL2L1-01        cgggacagcgtatcagagctttgaacaggtagtgaacgaactcttccggg
U3CRF8_BCL2L2-01        tggtgcaac--agcagaa----gagctggaagctcactttcatggctgtg
U3CRF8_BCL2L2-02        tggtgcaac--agcagaa----gagctggaagctcactttcatggctgtg
                                                       *                 *

F7HXW0_BCL2A1-01        gcattattaactggggaagaat----tgtaaccatatttg----------
A0A2R8MY14_BCL2-01      acggggtgaactgggggaggat----tgtggccttctttgagt-------
F7GTF7_MCL1-01          gcgtaacaaactggggtag-------gattgtgactctcatttcttttgg
F7GTF7_MCL1-02          gcgtaacaaactggggtag-------gattgtgactctcatttcttttgg
A0A5F4WGS2_BCL2L10      gctgaaggagccgg---ag-------ggcgacgtcgcacgggactgccag
F7CT87_BCL2L10-01       gctgaaggagccgg---aa-------ggcgacgtcgcccgggactgccag
F7IT36_BCL2L1-01        atggggtaaactggggtcgcat----tgtggccttttt-----ctcct--
U3CRF8_BCL2L2-01        gttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatc--
U3CRF8_BCL2L2-02        gttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatc--
                                * * *                                     

F7HXW0_BCL2A1-01        --catttgaaggtattctcatcaagaaacttctacgagag----------
A0A2R8MY14_BCL2-01      --tcggtggggtcatgtgtgtggagagcgtcaaccgggag---atgtcgc
F7GTF7_MCL1-01          tgcctttgtggccaaacacttgaagaccataaaccaagaa----------
F7GTF7_MCL1-02          tgcctttgtggccaaacacttgaagaccataaaccaagaa----------
A0A5F4WGS2_BCL2L10      cgcc-tggtggc------cttgatga------------------------
F7CT87_BCL2L10-01       cgcc-tggtggc------cttgctga------------------------
F7IT36_BCL2L1-01        --tcggcggggcactgtgcgtggaaagcgtagacaaggag---atgcagg
U3CRF8_BCL2L2-01        --ccaaagggtttgcatatatagagttctcagacaaagagtcagtgagga
U3CRF8_BCL2L2-02        --ccaaagggtttgcatatatagagttctcagacaaagagtcagtgagga
                               *            *                             

F7HXW0_BCL2A1-01        ----------------cgaattgccccggatgtggatacttacaaggaga
A0A2R8MY14_BCL2-01      ccctggtg-----gacaacatcgccctgtggatgaccgagtacctgaa--
F7GTF7_MCL1-01          -------------agctgcattgaaccattagcagaaagtatcacaga--
F7GTF7_MCL1-02          -------------agctgcattgaaccattagcagaaagtatcacaga--
A0A5F4WGS2_BCL2L10      ---------------------------gcccgcgg---------------
F7CT87_BCL2L10-01       ---------------------------gttcgcgg---------------
F7IT36_BCL2L1-01        tattggtg-----agtcggatcgcagcttggatggccacttacctgaa--
U3CRF8_BCL2L2-01        cttccttggccttagatgagtccctatttagaggaaggcagatcaagg--
U3CRF8_BCL2L2-02        cttccttggccttagatgagtccctatttagaggaaggcagatcaagg--
                                                                          

F7HXW0_BCL2A1-01        tctcacattttgttgctgagttcataatgaataacacaggagaatggata
A0A2R8MY14_BCL2-01      ----------------ccggc---------acct---gcacacctggatc
F7GTF7_MCL1-01          ----------------cgttctcgtaaggacaaa---acgggactggcta
F7GTF7_MCL1-02          ----------------cgttctcgtaaggacaaa---acgggactggcta
A0A5F4WGS2_BCL2L10      --------------------ctcgtgggacagca---ccgtgcctggctg
F7CT87_BCL2L10-01       --------------------ctcgtggggcagca---ccgtgcctggctg
F7IT36_BCL2L1-01        ----------------tgacc---------acct---agagccttggatc
U3CRF8_BCL2L2-01        ----------------tgatcccaaaacgaacca---acagaccaggcat
U3CRF8_BCL2L2-02        ----------------tgatcccaaaacgaacca---acagaccaggcat
                                                                     **   

F7HXW0_BCL2A1-01        agacaaaacggaggctgggggaaatggcacagtctcatgcttatgctagt
A0A2R8MY14_BCL2-01      caggataacggaggctgggatgcctttgtggaact---------gtatgg
F7GTF7_MCL1-01          gttaaacaaagaggctgggatgggtttgtggagttcttccatgtaga-gg
F7GTF7_MCL1-02          gttaaacaaagaggctgggatgggtttgtggagttcttccatgtaga-gg
A0A5F4WGS2_BCL2L10      gaggctcagggcggctgggatggcttttgttacttcttc-------a-gg
F7CT87_BCL2L10-01       gaggctcagggcggctgggatggcttttgttacttcttc-------a-gg
F7IT36_BCL2L1-01        caggagaacggcggctgggacacttttgtggaactc---------tatgg
U3CRF8_BCL2L2-01        cagcacaaca--gaccggg--gttttccacgagcccgctaccgcgcacgg
U3CRF8_BCL2L2-02        cagcacaaca--gaccggg--gttttccacgagcccgctaccgcgcacgg
                               *    * * ***     *                       * 

F7HXW0_BCL2A1-01        atc--------------------agt-----------ggcccagaaga--
A0A2R8MY14_BCL2-01      ccccagca-tgcggcctctgtttgatttctcctggctgtctctgaaga--
F7GTF7_MCL1-01          acctagaa----ggt--------ggc-----------atc----agaa--
F7GTF7_MCL1-02          acctagaa----ggt--------ggc-----------atc----agaa--
A0A5F4WGS2_BCL2L10      acctccta-ctcgct--------ggc-----------attatggagaa--
F7CT87_BCL2L10-01       acctcctc-cttgct--------ggc-----------attatggagaa--
F7IT36_BCL2L1-01        a--aacaa-tgcggc--------ag-------ccgagagccgaaagggcc
U3CRF8_BCL2L2-01        accaccaactacaac--------agttcccgctctcgattctacagtg--
U3CRF8_BCL2L2-02        accaccaactacaac--------agttcccgctctcgattctacagtg--
                                                                    *     

F7HXW0_BCL2A1-01        -----------------------------------agaggaaaatggctt
A0A2R8MY14_BCL2-01      -----------ctctgctcagcttggtcct-----ggtgggagct-----
F7GTF7_MCL1-01          -----------atgtgctg--ctggcttttgc---gggtgttgctggagt
F7GTF7_MCL1-02          -----------atgtgctg--ctggcttttgc---gggtgttgctggagt
A0A5F4WGS2_BCL2L10      -----------aactgctggtccaggttttcc---tgtcatggttg--tt
F7CT87_BCL2L10-01       -----------aagtgctggtccaggttttcc---tgtcatggttg--tt
F7IT36_BCL2L1-01        aggagcgcttcaaccgctggttcctgacgggcat-gactgtggccggcgt
U3CRF8_BCL2L2-01        ------gttttaacagcaggccccggggtcgcgtctacaggggccgggct
U3CRF8_BCL2L2-02        ------gttttaacagcaggccccggggtcgcgtctacaggggccgggct
                                                                          

F7HXW0_BCL2A1-01        tg----------------------------------taa
A0A2R8MY14_BCL2-01      ---tgcatcaccctgggtgcctatctgggccacaagtga
F7GTF7_MCL1-01          aggagctgggt--tggcatatct---aataa---gatag
F7GTF7_MCL1-02          aggagctgggt--tggcatatct---aataa---gatag
A0A5F4WGS2_BCL2L10      aacagcagcat--tcatctacttctggacac---gataa
F7CT87_BCL2L10-01       aacagcagtat--tcatctacttctggacac---gataa
F7IT36_BCL2L1-01        gg-ttctgc----tgggctcactctttagtcggaaatga
U3CRF8_BCL2L2-01        ag-agcgacatcatggtattcccctt--------actaa
U3CRF8_BCL2L2-02        ag-agcgacatcatggtattcccctt--------actaa
                                                            *  

© 1998-2021Legal notice