Dataset for CDS Unclassified of Organism Lates calcarifer

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A4W6G5L8_uncBCLWAV-01 Putative BCL2 homolog found in water-living anamniote vertebrates gene OS=[Eukaryota] Lates calcarifer (length=612 residues).
atgtgtcagtcagaggagcctcaggccagactgggtctgaacagtcctgatctgctggtgagagaggcttttctgatggc
ccatgactatatagactatgtaaccacagggggggctgatgggaccatgggtcctgcccccacagcctgcactgcagccc
tgcgccacgccggagatgaactcctaaaccgtttccccatcttcttcaggcgctggcctcgcgtcttccaggatgtgacg
gagaacacagcctgccccacgctcatgagcatccttgatgagcacttctttccccctgtccctgggggacaccgcaggga
cctggcctggagtgcagtgttgtctgtgtatgtgctggctggccagatggctctgcattgccatgagaggggcatgatgg
tggtcctgccccagctgaaggagtgtgtgggggcctatgtggagagggtcatctgccctgaaatacgagacaagggagga
tggagtggttttgtgttacgctttggagagaagcaggacttggagggccaggtgaagaagttgtgctgctggacactgct
ggctttggccataagcattctcacctacttcatgtggaaacgaatggtttag
© 1998-2023Legal notice