Dataset for CDS BCL-2-like of organism Amphiprion clarkii

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A6G7K5D7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Amphiprion clarkii GN=BCL2L1 (length=627 residues).
atgtcgtacagtaacagagagctggtggagttctttgtaagctacaagctgtctcaaaggaactatccgacgtctctgct
gaggccagaggatgctggaggaaggactgatggggacaaggccaactcagcttccagtaacggcttgctggtgaacagca
gaggcggcatagaggctgtaaaatccgcacttaaggacgcggcagatgagtttgaacttctcttcacgcaggcttttagt
gacctgtcttcacagcttgacatcacccctgaaacggcctaccacagctttaagagtgtgatggacgaggtgttcaagga
tggggtcaactggggacgtatagtgggcctgttttgctttggcggtgtactgtgtgtggaatgcgtagagaagaatatga
gcgagctggttccccgcatcgctgactggatgaccatgtacctggatgagcacatcagtctgtggatccaaagccaagga
ggatgggagtgctttgctgagatttttgggcagaacgccgctgcagaagcacgaaggtctcgggatactctgaagagatg
gctgctagtcggaggggtgctgctaatgggagttctggctggtgtgctcattgctaagaaacagtga
© 1998-2020Legal notice