Dataset for CDS BAX-like of Organism Dicentrarchus labrax

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C4EG79_BOK-01      atggaggtcctgcgtaggtcctctgtgtttgctgcagaggtcctggatgt
A0A8C4I2Z8_BOK-01      atggatatgttgcgccgctcgtctgtgtttgcggctgag---------gt
A0A8C4NTD7_BAX-01      atg----------gcgg-acagccg-------agaagaggagaaaaaaga
A0A8C4H3M6_BAX-01      atg----------gcatcacacccg-------ggaggaggcgataaagtg
A0A8C4H3M6_BAX-02      atg----------gcatcacacccg-------ggaggaggcgataaagga
                       ***          *     *  * *        *  ***           

A0A8C4EG79_BOK-01      atttgaccg-----------gtcgttgactgagaaggagctggt------
A0A8C4I2Z8_BOK-01      gttcgaccg-----------ctcgcccaccgacaaggagctggt------
A0A8C4NTD7_BAX-01      aagagacca-ggagcctcagggcgccgttggaggggaagatgtcatcgat
A0A8C4H3M6_BAX-01      agtatacagttgggcttctcattattgagctgggtaaagag--------c
A0A8C4H3M6_BAX-02      aat-----------------------------ggaaaagat--------c
                                                            **           

A0A8C4EG79_BOK-01      ------gtcccagtctaaagccttgtg-----------cagagactacat
A0A8C4I2Z8_BOK-01      ------gtcccaggccaaagcactgtg-----------cagggactacat
A0A8C4NTD7_BAX-01      gatcccatcctggagcaaggagcagtg------gtcctcagagg----gt
A0A8C4H3M6_BAX-01      gagatcatacttatattactatgcgtttgtctctcgcttcctagtttcat
A0A8C4H3M6_BAX-02      ag----atactggaagtaggagctgtt------ttgttaaaagatttcat
                              * *       *      **                       *

A0A8C4EG79_BOK-01      actgtccagactcaaccagaatggactcggatggtccaaaactgaactca
A0A8C4I2Z8_BOK-01      tcactccaggctgaaccgtgccgggataggctggtctaagcctgaacacg
A0A8C4NTD7_BAX-01      atgtgattgagcgtataaacacagaggaccctgatcgacatgtctcctct
A0A8C4H3M6_BAX-01      ttacgagcgggtgcggcgacatgga-gacagcaatactgaagtgaccagg
A0A8C4H3M6_BAX-02      ttacgagcgggtgcggcgacatgga-gacagcaatactgaagtgaccagg
                               *              *          *       *   *   

A0A8C4EG79_BOK-01      acttctctccctcaaatg------cagcgctggct-------------ga
A0A8C4I2Z8_BOK-01      gactggctgcatcaggtg------ggacgctggga-------------ga
A0A8C4NTD7_BAX-01      gaggatctgggaggaaggcctaatgaacaacaggatccacatatcaaaga
A0A8C4H3M6_BAX-01      gcacagctgggtggagga------gagctgtgtgacccgaaccagaagaa
A0A8C4H3M6_BAX-02      gcacagctgggtggagga------gagctgtgtgacccgaaccagaagaa
                             **                   *                     *

A0A8C4EG79_BOK-01      ggtgtctttggtgcttctctgtcttggcgacgagctggagtgtatacagc
A0A8C4I2Z8_BOK-01      gatatcgtcggttctgctgtggctgggtgatgagttggagtaccttcggc
A0A8C4NTD7_BAX-01      cgtggtggaacaactgatcaagattgcagacgagctga------------
A0A8C4H3M6_BAX-01      gcttgcccagtgtctgcagcagattggagatgagctgg------------
A0A8C4H3M6_BAX-02      gcttgcccagtgtctgcagcagattggagatgagctgg------------
                         *          **        * *  ** *** **             

A0A8C4EG79_BOK-01      ccagcttgtacaggaacgtggcgc------ggcagctcaac-------at
A0A8C4I2Z8_BOK-01      ccaacgtttaccgcaatgtagcgc------gacagctcaac-------at
A0A8C4NTD7_BAX-01      ---------acaggaatgctgagctccaacgactggtcaaccaggttcag
A0A8C4H3M6_BAX-01      ---------atggcaatgttgagctccaaagaatgttaaacgactctgcg
A0A8C4H3M6_BAX-02      ---------atggcaatgttgagctccaaagaatgttaaacgactctgcg
                                *  * ** *  * **      *   * * ***         

A0A8C4EG79_BOK-01      ttctgttgccatggagagcatggtttcagatgccttcatcggcgtggcaa
A0A8C4I2Z8_BOK-01      cacagtggcgtcagagagcattgtgtccgacgccttcctggctgtggctg
A0A8C4NTD7_BAX-01      gacaattgtgctaaggaa-------------gtcttcatgacggtggcca
A0A8C4H3M6_BAX-01      ctcagtccctcaaaagaa-------------gtgtttctgaaagttgccg
A0A8C4H3M6_BAX-02      ctcagtccctcaaaagaa-------------gtgtttctgaaagttgccg
                         *  *         **              *  **  *    ** **  

A0A8C4EG79_BOK-01      cagagatcttctcaacaggta---------------------taacgtgg
A0A8C4I2Z8_BOK-01      cagacattttctccacaggtaggtccacatcaaaatccggtgtgacatgg
A0A8C4NTD7_BAX-01      ggagcatctttgctgatggca---------------------tcaactgg
A0A8C4H3M6_BAX-01      ttgagatcttttcagatggaaagt------------------tcaactgg
A0A8C4H3M6_BAX-02      ttgagatcttttcagatggaaagt------------------tcaactgg
                            ** **  *    ** *                     * *  ***

A0A8C4EG79_BOK-01      ggtaaggtggtatccatgtacgcagtcgccggagctctggcagtggattg
A0A8C4I2Z8_BOK-01      gggaaggtggtttctttgtacgccgtggcaggagccttggcagtggactg
A0A8C4NTD7_BAX-01      ggtcgagtggtggctctcttc-----------catctggcctatagac--
A0A8C4H3M6_BAX-01      ggcagggtggtggcactgttc-----------tattttgcctgtcgac--
A0A8C4H3M6_BAX-02      ggcagggtggtggcactgttc-----------tattttgcctgtcgac--
                       **    *****  *  * * *                 * *  * **   

A0A8C4EG79_BOK-01      tgttagacaagg-------------acatccaaccactgttcatatctta
A0A8C4I2Z8_BOK-01      tgttcgccacgg-------------tcatccagctatggtccataccatt
A0A8C4NTD7_BAX-01      tcatatacaaggcactgaccagcaaccatctagagaacatcagaaccgtc
A0A8C4H3M6_BAX-01      tcgtcatcaaagctcttgtgactcaagttcctgatattatcagaacaatt
A0A8C4H3M6_BAX-02      tcgtcatcaaagctcttgtgactcaagttcctgatattatcagaacaatt
                       *  *   **  *                **     *   *    *   * 

A0A8C4EG79_BOK-01      gtggacagtttgggtcagtttgtccgcaagt--ttctggttcactggctg
A0A8C4I2Z8_BOK-01      gtcgactgcatgggggagtttgtccgcaaga--gcctgacctcctggttg
A0A8C4NTD7_BAX-01      atcagctgggttctccagatcatcagagagaagatctactc--ctggatc
A0A8C4H3M6_BAX-01      atcagctgga--ccatggactacctccgggaacatgtgatcaactggata
A0A8C4H3M6_BAX-02      atcagctgga--ccatggactacctccgggaacatgtgatcaactggata
                        *   * *         *     *     *      *      **** * 

A0A8C4EG79_BOK-01      aagagacggggaggatgggcggagatcacaaagtgtgtggtgaagaagga
A0A8C4I2Z8_BOK-01      aaaaggagagggggctgggtggatgtaacaaaatgcgtggtgaacacgga
A0A8C4NTD7_BAX-01      atacagcagggaggctgggaaggggt----------------------ga
A0A8C4H3M6_BAX-01      agagatcaaggtggctgggagggtattc--------------------gt
A0A8C4H3M6_BAX-02      agagatcaaggtggctgggagggtattc--------------------gt
                       *        ** ** ****  *   *                      * 

A0A8C4EG79_BOK-01      tctcacccccgaacaccac--tggctatcctctaccatggagtccctgaa
A0A8C4I2Z8_BOK-01      tcccagtttccgctctcac--tggctggtgtctgctgtctgtgcatttgg
A0A8C4NTD7_BAX-01      tcc----atggtttttctcggtggaggacagtagccatagtagcatcagt
A0A8C4H3M6_BAX-01      tcctactttggcacacccacatggcagacggtgggagttttcttggctgg
A0A8C4H3M6_BAX-02      tcctactttggcacacccacatggcagacggtgggagttttcttggctgg
                       **              *    ***             *            

A0A8C4EG79_BOK-01      gtacttcctca---ccacgatgtacatctacatcatgaaagaaccgtga
A0A8C4I2Z8_BOK-01      acactatctgaaggccacggtgt---tatacctcctccgggagaagtga
A0A8C4NTD7_BAX-01      a---gtattgg---tagcatctattgtttactacaggaagactcgctga
A0A8C4H3M6_BAX-01      a---gttctca---ccactgttctcgtcattcgcaagatg------tga
A0A8C4H3M6_BAX-02      a---gttctca---ccactgttctcgtcattcgcaagatg------tga
                               *        *        *      *            ***

© 1998-2023Legal notice