Dataset for CDS BAX-like of Organism Dicentrarchus labrax

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A8C4EG79_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Dicentrarchus labrax GN=BOK (length=642 residues).
atggaggtcctgcgtaggtcctctgtgtttgctgcagaggtcctggatgtatttgaccggtcgttgactgagaaggagct
ggtgtcccagtctaaagccttgtgcagagactacatactgtccagactcaaccagaatggactcggatggtccaaaactg
aactcaacttctctccctcaaatgcagcgctggctgaggtgtctttggtgcttctctgtcttggcgacgagctggagtgt
atacagcccagcttgtacaggaacgtggcgcggcagctcaacatttctgttgccatggagagcatggtttcagatgcctt
catcggcgtggcaacagagatcttctcaacaggtataacgtggggtaaggtggtatccatgtacgcagtcgccggagctc
tggcagtggattgtgttagacaaggacatccaaccactgttcatatcttagtggacagtttgggtcagtttgtccgcaag
tttctggttcactggctgaagagacggggaggatgggcggagatcacaaagtgtgtggtgaagaaggatctcacccccga
acaccactggctatcctctaccatggagtccctgaagtacttcctcaccacgatgtacatctacatcatgaaagaaccgt
ga
>gnl|bcl2dbcds|A0A8C4H3M6_BAX-01 BCL2-associated X gene OS=[Eukaryota] Dicentrarchus labrax GN=BAX (length=618 residues).
atggcatcacacccgggaggaggcgataaagtgagtatacagttgggcttctcattattgagctgggtaaagagcgagat
catacttatattactatgcgtttgtctctcgcttcctagtttcatttacgagcgggtgcggcgacatggagacagcaata
ctgaagtgaccagggcacagctgggtggaggagagctgtgtgacccgaaccagaagaagcttgcccagtgtctgcagcag
attggagatgagctggatggcaatgttgagctccaaagaatgttaaacgactctgcgctcagtccctcaaaagaagtgtt
tctgaaagttgccgttgagatcttttcagatggaaagttcaactggggcagggtggtggcactgttctattttgcctgtc
gactcgtcatcaaagctcttgtgactcaagttcctgatattatcagaacaattatcagctggaccatggactacctccgg
gaacatgtgatcaactggataagagatcaaggtggctgggagggtattcgttcctactttggcacacccacatggcagac
ggtgggagttttcttggctggagttctcaccactgttctcgtcattcgcaagatgtga
>gnl|bcl2dbcds|A0A8C4H3M6_BAX-02 BCL2-associated X gene OS=[Eukaryota] Dicentrarchus labrax GN=BAX (length=579 residues).
atggcatcacacccgggaggaggcgataaaggaaatggaaaagatcagatactggaagtaggagctgttttgttaaaaga
tttcatttacgagcgggtgcggcgacatggagacagcaatactgaagtgaccagggcacagctgggtggaggagagctgt
gtgacccgaaccagaagaagcttgcccagtgtctgcagcagattggagatgagctggatggcaatgttgagctccaaaga
atgttaaacgactctgcgctcagtccctcaaaagaagtgtttctgaaagttgccgttgagatcttttcagatggaaagtt
caactggggcagggtggtggcactgttctattttgcctgtcgactcgtcatcaaagctcttgtgactcaagttcctgata
ttatcagaacaattatcagctggaccatggactacctccgggaacatgtgatcaactggataagagatcaaggtggctgg
gagggtattcgttcctactttggcacacccacatggcagacggtgggagttttcttggctggagttctcaccactgttct
cgtcattcgcaagatgtga
>gnl|bcl2dbcds|A0A8C4I2Z8_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Dicentrarchus labrax GN=BOK (length=654 residues).
atggatatgttgcgccgctcgtctgtgtttgcggctgaggtgttcgaccgctcgcccaccgacaaggagctggtgtccca
ggccaaagcactgtgcagggactacattcactccaggctgaaccgtgccgggataggctggtctaagcctgaacacggac
tggctgcatcaggtgggacgctgggagagatatcgtcggttctgctgtggctgggtgatgagttggagtaccttcggccc
aacgtttaccgcaatgtagcgcgacagctcaacatcacagtggcgtcagagagcattgtgtccgacgccttcctggctgt
ggctgcagacattttctccacaggtaggtccacatcaaaatccggtgtgacatgggggaaggtggtttctttgtacgccg
tggcaggagccttggcagtggactgtgttcgccacggtcatccagctatggtccataccattgtcgactgcatgggggag
tttgtccgcaagagcctgacctcctggttgaaaaggagagggggctgggtggatgtaacaaaatgcgtggtgaacacgga
tcccagtttccgctctcactggctggtgtctgctgtctgtgcatttggacactatctgaaggccacggtgttatacctcc
tccgggagaagtga
>gnl|bcl2dbcds|A0A8C4NTD7_BAX-01 BCL2-associated X gene OS=[Eukaryota] Dicentrarchus labrax GN=BAX (length=618 residues).
atggcggacagccgagaagaggagaaaaaagaaagagaccaggagcctcagggcgccgttggaggggaagatgtcatcga
tgatcccatcctggagcaaggagcagtggtcctcagagggtatgtgattgagcgtataaacacagaggaccctgatcgac
atgtctcctctgaggatctgggaggaaggcctaatgaacaacaggatccacatatcaaagacgtggtggaacaactgatc
aagattgcagacgagctgaacaggaatgctgagctccaacgactggtcaaccaggttcaggacaattgtgctaaggaagt
cttcatgacggtggccaggagcatctttgctgatggcatcaactggggtcgagtggtggctctcttccatctggcctata
gactcatatacaaggcactgaccagcaaccatctagagaacatcagaaccgtcatcagctgggttctccagatcatcaga
gagaagatctactcctggatcatacagcagggaggctgggaaggggtgatccatggtttttctcggtggaggacagtagc
catagtagcatcagtagtattggtagcatctattgtttactacaggaagactcgctga
© 1998-2023Legal notice