Dataset for CDS BCL-2-like of organism Cyanistes caeruleus

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A8C0U194_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cyanistes caeruleus GN=BCL2L1 (length=693 residues).
atgtacagcagtaatcgggagttagtgattgactttgtttcctacaagctctcacagaaaggatacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcaggggaggaggacgagatggacggcgtcctcaacgggagcccctcct
ggcatgcacccaccagccacatagtgaacggagccaccgtccaccagagcagcctcgaagtccatgagatccgtcgagca
gctgacgtgaggcaggcgctgagagaggcgggggatgagtttgagctgaggtaccggcgggcgttcagcgacctcacttc
ccagctccacatcactcccagcacagcgtatcagagctttgagcaggtagtgaatgaactgttccgcgatggagtgaact
ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggagagcgttgttaaggagatgcgggtattggtg
aaacgcattgtgtcttggatgaccacgtacttgaccgaccacttagatccctggatccaggagaatggcggatgggagcg
ctttgtggacctctatgggaacgatgctgctgccgaggtgagaaaaggccaggagaccttcaacaaatggctcctgaccg
gggcgacggtggccggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8C0UAC7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyanistes caeruleus GN=BCL-2 (length=672 residues).
cagaggaacatatttatagcccaagctcatccggggagaagaggctatgataaccgggagatagtgctgaagtacatcca
ctataaactctcccagaggggatacgactgggctgccggcgaggacagggcacccctgtctccaggtctctctgctcctg
ctgctgctgctgggacttcctctgatcacactgggctggtgtctccgcaccccgagccccccggctcggctgctgctagc
cacgcgcccccggccgaggggctgcgccccgcaccccaggtcgtgcacctcgtcctgcgccaggcaggggatgagttctc
ccgacgctaccagagggactttgcccaaatgtctggccagctgcacctgacacccttcacggccaggagccgcttcgtgg
ccgtggtggaggagctcttccgagacggggttaactggggcagaattgtggccttcttcgagtttggcggtgtgatgtgt
gtggagagcgtcaaccgggagatgtctcccctcgtggacaacattgctgcctggatgactgagtacctgaaccggcacct
gcaccactggatccaggacaacggaggctgggtaagtcaccccgatcgctcgcttcctctccctgctccggcccgtggct
ggtgggaccccaggctgggcagcgccccagag
>gnl|bcl2dbcds|A0A8C0UE15_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyanistes caeruleus GN=MCL-1 (length=483 residues).
atgctctgcacatccctgagaggctcctgcagcttcaggagctccagtggtggtgggctcacaccccatccccgctcctc
ccgcggggttttggtgctcctaaacccaaatcttccaggaatgctgcggaagctggaaatccagcaagaggaggacctgc
agtcggtggtggaggtggctgcccacttgttcagcgatggggtgaccaactggggccgcgtggtgacgctcatcgccttc
ggagccttcgtggccaagcacctgaagagcatcaagcaggagcagagcatcagttccctggctgggatcatcacggacgc
cctggtctcgtccaagcgagagtggctggagagccaggggggctgggagggctttgtggactttttccgagtggaggacc
tggagggcagcatccggaacgttctgatggcgtttgcaggagtggccggcctgggggctggcttggcctacatgatccgg
tga
>gnl|bcl2dbcds|A0A8C0UPM3_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Cyanistes caeruleus GN=BCL2A1 (length=522 residues).
atgctgggggtgccttttgctttcaaagaaggaagagcagtgaaaagagagtatgtgctccaggaatcacagctcggacc
agcccagaccagggttgctcatgtcttgcgaaccattgcatcttccctgcaagaccaaaccgaggaggctctcaggccac
tcctggacaggattgacatcacctctgtagctgttgccaagagaattttcaatggagtcatggatgaaaagtttgctgat
ggaaatactaactggggacgaattatgaccatatttacatttggaggtcttctcaccaagaagcttcaagagcatggagt
tcagctgactgcagaggagaaggaggagatctcttatttcatcacagagtacatcataaacaacaaagctgaatggattg
atgcaaatggtggctgggaaaatggcttcctaacaaagtttgaaagaagatcactactgtctttctccaaaattacagcc
ctgctcatagctgttgtttccttgttcagagagtactactga
>gnl|bcl2dbcds|A0A8C0UPM3_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Cyanistes caeruleus GN=BCL2A1 (length=525 residues).
atggaaactgctgagttctattacgtttattacttagctcaggattatctgcagtatgtgctccaggaatcacagctcgg
accagcccagaccagggttgctcatgtcttgcgaaccattgcatcttccctgcaagaccaaaccgaggaggctctcaggc
cactcctggacaggattgacatcacctctgtagctgttgccaagagaattttcaatggagtcatggatgaaaagtttgct
gatggaaatactaactggggacgaattatgaccatatttacatttggaggtcttctcaccaagaagcttcaagagcatgg
agttcagctgactgcagaggagaaggaggagatctcttatttcatcacagagtacatcataaacaacaaagctgaatgga
ttgatgcaaatggtggctgggaaaatggcttcctaacaaagtttgaaagaagatcactactgtctttctccaaaattaca
gccctgctcatagctgttgtttccttgttcagagagtactactga
© 1998-2022Legal notice