Dataset for CDS BCL-2-like of organism Cyanistes caeruleus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C0UPM3_BCL2A1-      -----------------a--------------------------------
A0A8C0UPM3_BCL2A1-      -----------------a--------------------------------
A0A8C0U194_BCL2L1-      -----------------atgtacagca----------------------g
A0A8C0UAC7_BCL2-01      cagaggaacatatttatagcccaagctcatccggggagaagaggctatga
A0A8C0UE15_MCL1-01      -----------------atgctctgcacatccctg----agaggctcctg
                                         *                                

A0A8C0UPM3_BCL2A1-      ------tg----ct------gggggtgccttttgctt-------tcaaag
A0A8C0UPM3_BCL2A1-      ------tggaaact------gctgagttctattacgtttattacttagct
A0A8C0U194_BCL2L1-      taat--cgggagtt--agtgattgactttgtttcctacaagctctcacag
A0A8C0UAC7_BCL2-01      taac--cgggagat--agtgctgaagtacatccactataaactctcccag
A0A8C0UE15_MCL1-01      cagcttcaggagctccagtggtggtgggctcacaccccatccccgct---
                                     *                    *               

A0A8C0UPM3_BCL2A1-      aaggaagag-------cagtgaaaagagagtatgtgctccaggaatcaca
A0A8C0UPM3_BCL2A1-      caggattat-------ctgc--------agtatgtgctccaggaatcaca
A0A8C0U194_BCL2L1-      aaaggatacagctggagtcagctggaggaggagg-----atgagaacagg
A0A8C0UAC7_BCL2-01      aggggatacgactgggctgccggcgaggacagggcacccctgtctccagg
A0A8C0UE15_MCL1-01      ----------------cctcccgcggggttttggtgctcctaaacccaaa
                                                         *            **  

A0A8C0UPM3_BCL2A1-      gct-----------------------------------------------
A0A8C0UPM3_BCL2A1-      gct-----------------------------------------------
A0A8C0U194_BCL2L1-      actgactt----tgcaggggaggaggacgagatggacggcgtcctcaacg
A0A8C0UAC7_BCL2-01      tctctctgctcctgctgctgctgctgg----------gacttc-------
A0A8C0UE15_MCL1-01      tcttccag-gaatgctgcggaagctgg----------aaatccagcaaga
                         **                                               

A0A8C0UPM3_BCL2A1-      ------------------------------------------------cg
A0A8C0UPM3_BCL2A1-      ------------------------------------------------cg
A0A8C0U194_BCL2L1-      ggagcccctcctggca-----------------------tgcacccacca
A0A8C0UAC7_BCL2-01      -----ctctgatcacactgg-gctggtgtctccgcaccccgagccccccg
A0A8C0UE15_MCL1-01      ggaggacctgcagtcggtggtggaggtggct-----------gcccactt
                                                                          

A0A8C0UPM3_BCL2A1-      gaccagc---------------------ccagaccagggtt---gctcat
A0A8C0UPM3_BCL2A1-      gaccagc---------------------ccagaccagggtt---gctcat
A0A8C0U194_BCL2L1-      gccacatagtgaacggagccaccgtccaccagagcagcctcgaagtccat
A0A8C0UAC7_BCL2-01      gctcggc--tgctgctagccacgcgcccccggccgaggggctgcgccccg
A0A8C0UE15_MCL1-01      gttcagcgatggggtgaccaactgg-----ggccgcgtggtgacgctcat
                        *                              *    *       *  *  

A0A8C0UPM3_BCL2A1-      gtcttgcg------aaccattgcatcttccctgcaagaccaaaccgagga
A0A8C0UPM3_BCL2A1-      gtcttgcg------aaccattgcatcttccctgcaagaccaaaccgagga
A0A8C0U194_BCL2L1-      gagatccgtcgagcagctgacgtgaggcaggcgctgagagaggcggggga
A0A8C0UAC7_BCL2-01      caccccagg----------tcgtgcacctcgtcctgcgccaggcagggga
A0A8C0UE15_MCL1-01      cgccttcgg-----agccttcgtg-------------gccaagcacctga
                               *             *                  *  *    **

A0A8C0UPM3_BCL2A1-      ggctctcaggccac-------------------------tcctggacagg
A0A8C0UPM3_BCL2A1-      ggctctcaggccac-------------------------tcctggacagg
A0A8C0U194_BCL2L1-      tgagtttgagctgaggtaccggcgggcgttcagcgacctcacttcccagc
A0A8C0UAC7_BCL2-01      tgagttctcccgacgctaccagagggactttgcccaaatgtctggccagc
A0A8C0UE15_MCL1-01      agag--catcaagcaggagcagagca-------tcagttccctggctggg
                         *                                       **     * 

A0A8C0UPM3_BCL2A1-      attgacatcacctctgtagctgttgccaagagaattttcaatggagtcat
A0A8C0UPM3_BCL2A1-      attgacatcacctctgtagctgttgccaagagaattttcaatggagtcat
A0A8C0U194_BCL2L1-      tccac----atcactcccagcacagcgtatcagagctttgagcaggtagt
A0A8C0UAC7_BCL2-01      tgcac--ctgacaccct--tcacggccaggagccgcttcgtggccgtggt
A0A8C0UE15_MCL1-01      atcatcacggacgccctggtctcgtccaa----------gcgagagtggc
                                   * *           *                   **   

A0A8C0UPM3_BCL2A1-      ggatgaaaagtttgctgatggaaatactaactggggacgaattatgacca
A0A8C0UPM3_BCL2A1-      ggatgaaaagtttgctgatggaaatactaactggggacgaattatgacca
A0A8C0U194_BCL2L1-      gaatgaactgttccgcgatgga---gtgaactggggccgcatcgtggctt
A0A8C0UAC7_BCL2-01      ggaggagctcttccgagacggg---gttaactggggcagaattgtggcct
A0A8C0UE15_MCL1-01      tggagagcc--------agggg---g---gctgggagggctttgtggact
                            **           * **         *****   *  *  **    

A0A8C0UPM3_BCL2A1-      tatttacatttggaggtcttctcaccaagaagcttcaagagcatggagtt
A0A8C0UPM3_BCL2A1-      tatttacatttggaggtcttctcaccaagaagcttcaagagcatggagtt
A0A8C0U194_BCL2L1-      tcttctccttcggagga----------------gccttgtgcgtggagag
A0A8C0UAC7_BCL2-01      tcttcgagtttggcggt----------------gtgatgtgtgtggagag
A0A8C0UE15_MCL1-01      tttt---------ccga----------------gtggaggacctggaggg
                        * **           *                      *    *****  

A0A8C0UPM3_BCL2A1-      cagctgactgcagaggagaa-------ggaggagatctcttatttcatca
A0A8C0UPM3_BCL2A1-      cagctgactgcagaggagaa-------ggaggagatctcttatttcatca
A0A8C0U194_BCL2L1-      cgttgttaaggagatgcgggtattggtgaaacgcattgtgtcttggatga
A0A8C0UAC7_BCL2-01      cgtcaaccgggagatgtctcccctcgtggacaacattgctgcctggatga
A0A8C0UE15_MCL1-01      cagcatccgg---------------------aacgtt-------------
                        *        *                         *              

A0A8C0UPM3_BCL2A1-      cagagtacatcataaacaacaaagctgaatggattgatgcaaatggtggc
A0A8C0UPM3_BCL2A1-      cagagtacatcataaacaacaaagctgaatggattgatgcaaatggtggc
A0A8C0U194_BCL2L1-      ccacgtacttgaccgaccacttagatccctggatccaggagaatggcgga
A0A8C0UAC7_BCL2-01      ctgagtacctgaaccggcacctgcaccactggatccaggacaacggaggc
A0A8C0UE15_MCL1-01      --------ctga--tggcgtttg------------cagga-----gtggc
                                 * *                        * *      * ** 

A0A8C0UPM3_BCL2A1-      tgggaaaatggcttcctaacaaagtttgaaagaagatcactactgtcttt
A0A8C0UPM3_BCL2A1-      tgggaaaatggcttcctaacaaagtttgaaagaagatcactactgtcttt
A0A8C0U194_BCL2L1-      tgg-------------------------------gagcgct-ttgtggac
A0A8C0UAC7_BCL2-01      tgggtaagtcacccc-------------------gatcgct-cgcttcct
A0A8C0UE15_MCL1-01      cgg---------cct-------------------gggggct-ggcttggc
                         **                               *    **    *    

A0A8C0UPM3_BCL2A1-      ctccaaaattaca----------------------------------gcc
A0A8C0UPM3_BCL2A1-      ctccaaaattaca----------------------------------gcc
A0A8C0U194_BCL2L1-      ctctatgggaacgatgctgctgccgaggtgagaaaaggccaggagacctt
A0A8C0UAC7_BCL2-01      ctccctg----------------------------------------ctc
A0A8C0UE15_MCL1-01      ctacatg----------------------------------------atc
                        **                                                

A0A8C0UPM3_BCL2A1-      c-------tgctcatagctgttgtttccttgttcagag-agtactactga
A0A8C0UPM3_BCL2A1-      c-------tgctcatagctgttgtttccttgttcagag-agtactactga
A0A8C0U194_BCL2L1-      caacaaatggctcctgaccggggcgacggtggccggagtgcttctgctgg
A0A8C0UAC7_BCL2-01      c-------ggcccgtggctggtgggaccccaggctgggcagcgccccaga
A0A8C0UE15_MCL1-01      c-------ggt-------------------------------------ga
                        *        *                                      * 

A0A8C0UPM3_BCL2A1-      -----------------------
A0A8C0UPM3_BCL2A1-      -----------------------
A0A8C0U194_BCL2L1-      gatccctgctgagccgcaagtga
A0A8C0UAC7_BCL2-01      g----------------------
A0A8C0UE15_MCL1-01      -----------------------
                                               

© 1998-2022Legal notice