Dataset for CDS MCL-1 of organism Sinocyclocheilus rhinocerous

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A673IXK8_MCL1-01      at------------------------------------------------
A0A673MXF5_MCL1-01      at------------------------------------------------
A0A673HSI2_MCL1-01      at------------------------------------------------
A0A673GSK0_MCL1-03      ct------------------------------------------------
A0A673GSK0_MCL1-01      atgctgaaaatacagctgcgcatcacagaaataaattacagtttaacaga
A0A673GSK0_MCL1-02      at------------------------------------------------
                         *                                                

A0A673IXK8_MCL1-01      ------------gttccctgggagtaaagttttaaac-------------
A0A673MXF5_MCL1-01      ------------gttccctgggagtaaagtttcaaac-------------
A0A673HSI2_MCL1-01      -------------gactctgagtttggggaatagacc-------------
A0A673GSK0_MCL1-03      ------------aagctttaaccttcgacgttcagac-------------
A0A673GSK0_MCL1-01      tattcacatagaaaacagttattttaaatatttagtcagaagaacggctg
A0A673GSK0_MCL1-02      --------------------------------------------------
                                                                          

A0A673IXK8_MCL1-01      --------------------------------------------------
A0A673MXF5_MCL1-01      --------------------------------------------------
A0A673HSI2_MCL1-01      --------------------------------------------------
A0A673GSK0_MCL1-03      --------------------------------------------------
A0A673GSK0_MCL1-01      cggtcagtctgctcggcgcgcacacggcgctcgtgcccgcgcccgcactc
A0A673GSK0_MCL1-02      --------------------------------------------------
                                                                          

A0A673IXK8_MCL1-01      ---------------gacaaaggcttttggccatgcattggaataacagc
A0A673MXF5_MCL1-01      ---------------gacagcggcttttggccatgcattggaatagcagc
A0A673HSI2_MCL1-01      ---------------gatggctgcgttgggtgtcctcgcggatgagacgg
A0A673GSK0_MCL1-03      ------cgactcgaagacgagctcgacgggtg----cgcggatgaaccgg
A0A673GSK0_MCL1-01      aaaccgcggagcgaggacgagctcgacgggtg----cgcggatgaaccgg
A0A673GSK0_MCL1-02      --------------------------------------------------
                                                                          

A0A673IXK8_MCL1-01      tcttaacgtcaacagcagctcgggcgggcttggtcgcaagccactggtaa
A0A673MXF5_MCL1-01      tcttaacgtcaacaacagctcgagcgggtttggtcgcaagccacttgtaa
A0A673HSI2_MCL1-01      acgccgcgctgaagccgctgaggcccgg------gacgaacggcctgaaa
A0A673GSK0_MCL1-03      acgccgcggtgaagccggtaagaccggg------aaccaacggcctgaag
A0A673GSK0_MCL1-01      acgccgcggtgaagccggtaagaccggg------aaccaacggcctgaag
A0A673GSK0_MCL1-02      ----------------------accggg------aaccaacggcctgaag
                                                * **        * * *  *  * * 

A0A673IXK8_MCL1-01      tgccag-aactgaaaccccagaaccagtttacagggaacggactccaggg
A0A673MXF5_MCL1-01      tgccag-aactgaaagcccagaaccagttcacagggaacggtctccaggg
A0A673HSI2_MCL1-01      ggactgcagctggacggacggttcgtgtccgcgggagacggctctc----
A0A673GSK0_MCL1-03      ggactgcaactggacggacgcttcgtttgcgcggcggacggatctc----
A0A673GSK0_MCL1-01      ggactgcaactggacggacgcttcgtttgcgcggcggacggatctc----
A0A673GSK0_MCL1-02      ggactgcaactggacggacgcttcgtttgcgcggcggacggatctc----
                         * * * * *** *    *    *   *   * *   ****    *    

A0A673IXK8_MCL1-01      ctcggtaccatcctcgcctgagccggattgcgaggaagtacaagatgaat
A0A673MXF5_MCL1-01      ctcggtaccatcctcgcctgagacggactgcgaggaaat---agatgatt
A0A673HSI2_MCL1-01      -----taccggccaccccggacccg------caggagct-----------
A0A673GSK0_MCL1-03      -----taccgaacacaccggacccg------caggagtt-----------
A0A673GSK0_MCL1-01      -----taccgaacacaccggacccg------caggagtt-----------
A0A673GSK0_MCL1-02      -----taccgaacacaccggacccg------caggagtt-----------
                             ****   * * ** **  **       ****  *           

A0A673IXK8_MCL1-01      acacgtccatctatgacgctctggaaatggacacacgagagattattgac
A0A673MXF5_MCL1-01      acacctccatctacgccgccctggaaatggacacgcgagagattattgac
A0A673HSI2_MCL1-01      -------cggttc---------------cgacacgcagcagcttctgttg
A0A673GSK0_MCL1-03      -------cggttccgccgaactggatcgcgacacgagacagctcttgttg
A0A673GSK0_MCL1-01      -------cggttccgccgaactggatcgcgacacgagacagctcttgttg
A0A673GSK0_MCL1-02      -------cggttccgccgaactggatcgcgacacgagacagctcttgttg
                               *   *                 *****     ** *  *    

A0A673IXK8_MCL1-01      attttcttaaaaaactttactggattccctcattctaaaagtgggaataa
A0A673MXF5_MCL1-01      gctttcttaaaaagctttacaggactccctcattctaaaagtggaaaaaa
A0A673HSI2_MCL1-01      gacttctatcgcacgcacaccggaatgagtctcccggatcggaagcgtca
A0A673GSK0_MCL1-03      gatttctaccgcacgcacaccggaatgtgtccgcaggaccggaagcagca
A0A673GSK0_MCL1-01      gatttctaccgcacgcacaccggaatgtgtccgcaggaccggaagcagca
A0A673GSK0_MCL1-02      gatttctaccgcacgcacaccggaatgtgtccgcaggaccggaagcagca
                           ****     *     ** *** *   **      *  *        *

A0A673IXK8_MCL1-01      acaggttctggcaacgatgaatcgggttgtggaaagtcttgtggtgaagc
A0A673MXF5_MCL1-01      ccaggttctgtctacgatgaagcgggttgtggacagtctcgcggtgaagc
A0A673HSI2_MCL1-01      tcacgcgttaccgacaatgaagcgcgtcgtcgcggacgtcctcataaagc
A0A673GSK0_MCL1-03      tcacgcgctaccgacaatgactcgcgttgtcgcggacgttctcttaaagc
A0A673GSK0_MCL1-01      tcacgcgctaccgacaatgactcgcgttgtcgcggacgttctcttaaagc
A0A673GSK0_MCL1-02      tcacgcgctaccgacaatgactcgcgttgtcgcggacgttctcttaaagc
                         ** *   *  * ** ****  ** ** ** *      *     * ****

A0A673IXK8_MCL1-01      acgaactggcttacaaaggtatgattgcacgtctgaatctggagcagaaa
A0A673MXF5_MCL1-01      acgaactggcttacaaaggtatgattgcacggctgaatctggagcagaaa
A0A673HSI2_MCL1-01      accagatcacttacacagggatgctgcagcgtctgcagctggactctcag
A0A673GSK0_MCL1-03      acgagactacattcaaaggaatgttgcagcgtctacagctggaatctcaa
A0A673GSK0_MCL1-01      acgagactacattcaaaggaatgttgcagcgtctacagctggaatctcaa
A0A673GSK0_MCL1-02      acgagactacattcaaaggaatgttgcagcgtctacagctggaatctcaa
                        ** *     * * ** *** *** *    ** **  * *****     * 

A0A673IXK8_MCL1-01      ggagaagatgtgagtttcgtcaagactgttgcaacagaactcttcagcga
A0A673MXF5_MCL1-01      ggagaagatgtgagttttgtcaagactgtggcaacagaactcttcagcga
A0A673HSI2_MCL1-01      ccggacgacttgagcgtcatcgactgtatagcaaagacgatgttcagaga
A0A673GSK0_MCL1-03      gcagacgacatgagcttcatcagctttatagcagagacgatgttcagaga
A0A673GSK0_MCL1-01      gcagacgacatgagcttcatcagctttatagcagagacgatgttcagaga
A0A673GSK0_MCL1-02      gcagacgacatgagcttcatcagctttatagcagagacgatgttcagaga
                           ** **  ****  *  **     * * ***       * ***** **

A0A673IXK8_MCL1-01      tggcatcacaaactggggtcgcattgccagcctgcttactcttggggcaa
A0A673MXF5_MCL1-01      tggcatcacaaactgggggcgcatttgcagcctgctgacttttggggcac
A0A673HSI2_MCL1-01      cgacaccaccaactggggccggatcgtgagtctggtggccttcggggccg
A0A673GSK0_MCL1-03      cgacaccaccaactggggccggatcgtgagtctggtggccttcggggctg
A0A673GSK0_MCL1-01      cgacaccaccaactggggccggatcgtgagtctggtggccttcggggctg
A0A673GSK0_MCL1-02      cgacaccaccaactggggccggatcgtgagtctggtggccttcggggctg
                         * ** *** ******** ** **    ** *** *  *  * *****  

A0A673IXK8_MCL1-01      tggtatgcaagcatcagaatga----taaaggacttagcaagtgtgcgag
A0A673MXF5_MCL1-01      tggtatgcaagcatcaaaatga----tagaggacttagcaagtgtgtgag
A0A673HSI2_MCL1-01      tggtgtgctcgcagctgaaggagctgcagaggg---agc-ggtgcgtgga
A0A673GSK0_MCL1-03      tggtgtgctcgcgtctgaaagagctgcagaggg---agc-ggtgcgtgga
A0A673GSK0_MCL1-01      tggtgtgctcgcgtctgaaagagctgcagaggg---agc-ggtgcgtgga
A0A673GSK0_MCL1-02      tggtgtgctcgcgtctgaaagagctgcagaggg---agc-ggtgcgtgga
                        **** ***  **  *  ** **     * ***    ***  *** * *  

A0A673IXK8_MCL1-01      tctggtggggaaagagatctcttcctatcttctcataacccagcgggact
A0A673MXF5_MCL1-01      tctggtgggggaagagatctcttcctatcttctcacagaccaacgggact
A0A673HSI2_MCL1-01      gacggtggcccagcagatctcctcctatctgatctcagaacagcacgact
A0A673GSK0_MCL1-03      gacggtgacccagcagatctcctcctatctgatctcagaacagcacgact
A0A673GSK0_MCL1-01      gacggtgacccagcagatctcctcctatctgatctcagaacagcacgact
A0A673GSK0_MCL1-02      gacggtgacccagcagatctcctcctatctgatctcagaacagcacgact
                           ****    *  ******* ********  **  *   ** *  ****

A0A673IXK8_MCL1-01      ggctgctcaaaaacaatgcatgggatggctttgtggaattttttcatgtc
A0A673MXF5_MCL1-01      ggctgctcaaaaacaaagcatgggatggctttgtggcattttttcatgtc
A0A673HSI2_MCL1-01      ggctgctcaacaacaagggctggcatgggttcgaggagttcttccgcgtg
A0A673GSK0_MCL1-03      ggctgctcaacaacaa------gcatggattcgtggagtttttccacgtg
A0A673GSK0_MCL1-01      ggctgctcaacaacaa------gcatggattcgtggagtttttccacgtg
A0A673GSK0_MCL1-02      ggctgctcaacaacaa------gcatggattcgtggagtttttccacgtg
                        ********** *****      * **** ** * **  ** ** *  ** 

A0A673IXK8_MCL1-01      ccaaatacagaagcggctgtgagaaacacattgatggccattggtagtgt
A0A673MXF5_MCL1-01      ccggatacagaggcagctatgagaaacacattgatggccattggtggtgt
A0A673HSI2_MCL1-01      gaggacgtggagtctgtggtccgcagcgctctgatggctg-ttgtgggat
A0A673GSK0_MCL1-03      gaggatgtggagtctgtgattcgtaatgctttgatggctg-tggtgggat
A0A673GSK0_MCL1-01      gaggatgtggagtctgtgattcgtaatgctttgatggctg-tggtgggat
A0A673GSK0_MCL1-02      gaggatgtggagtctgtgattcgtaatgctttgatggctg-tggtgggat
                            *    **  * *   *  * *   *  *******   * ** *  *

A0A673IXK8_MCL1-01      g-gctacattcggagctgcacttgcttatttgatacggtga
A0A673MXF5_MCL1-01      g-gcaacattcggagctgctcttgcttatttgatacggtga
A0A673HSI2_MCL1-01      gtgctgggatcggcgccggtctcgctctcctgatccgatga
A0A673GSK0_MCL1-03      gcgctgggatcggcgccggtctcgctttcctgatccggtga
A0A673GSK0_MCL1-01      gcgctgggatcggcgccggtctcgctttcctgatccggtga
A0A673GSK0_MCL1-02      gcgctgggatcggcgccggtctcgctttcctgatccggtga
                        * **     **** ** *  ** ***    **** ** ***

© 1998-2020Legal notice