Dataset for CDS MCL-1 of organism Sinocyclocheilus rhinocerous

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|A0A673GSK0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus rhinocerous GN=MCL-1 (length=837 residues).
atgctgaaaatacagctgcgcatcacagaaataaattacagtttaacagatattcacatagaaaacagttattttaaata
tttagtcagaagaacggctgcggtcagtctgctcggcgcgcacacggcgctcgtgcccgcgcccgcactcaaaccgcgga
gcgaggacgagctcgacgggtgcgcggatgaaccggacgccgcggtgaagccggtaagaccgggaaccaacggcctgaag
ggactgcaactggacggacgcttcgtttgcgcggcggacggatctctaccgaacacaccggacccgcaggagttcggttc
cgccgaactggatcgcgacacgagacagctcttgttggatttctaccgcacgcacaccggaatgtgtccgcaggaccgga
agcagcatcacgcgctaccgacaatgactcgcgttgtcgcggacgttctcttaaagcacgagactacattcaaaggaatg
ttgcagcgtctacagctggaatctcaagcagacgacatgagcttcatcagctttatagcagagacgatgttcagagacga
caccaccaactggggccggatcgtgagtctggtggccttcggggctgtggtgtgctcgcgtctgaaagagctgcagaggg
agcggtgcgtggagacggtgacccagcagatctcctcctatctgatctcagaacagcacgactggctgctcaacaacaag
catggattcgtggagtttttccacgtggaggatgtggagtctgtgattcgtaatgctttgatggctgtggtgggatgcgc
tgggatcggcgccggtctcgctttcctgatccggtga
>gnl|bcl2dbcds|A0A673GSK0_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus rhinocerous GN=MCL-1 (length=621 residues).
ataccgggaaccaacggcctgaagggactgcaactggacggacgcttcgtttgcgcggcggacggatctctaccgaacac
accggacccgcaggagttcggttccgccgaactggatcgcgacacgagacagctcttgttggatttctaccgcacgcaca
ccggaatgtgtccgcaggaccggaagcagcatcacgcgctaccgacaatgactcgcgttgtcgcggacgttctcttaaag
cacgagactacattcaaaggaatgttgcagcgtctacagctggaatctcaagcagacgacatgagcttcatcagctttat
agcagagacgatgttcagagacgacaccaccaactggggccggatcgtgagtctggtggccttcggggctgtggtgtgct
cgcgtctgaaagagctgcagagggagcggtgcgtggagacggtgacccagcagatctcctcctatctgatctcagaacag
cacgactggctgctcaacaacaagcatggattcgtggagtttttccacgtggaggatgtggagtctgtgattcgtaatgc
tttgatggctgtggtgggatgcgctgggatcggcgccggtctcgctttcctgatccggtga
>gnl|bcl2dbcds|A0A673GSK0_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus rhinocerous GN=MCL-1 (length=708 residues).
ctaagctttaaccttcgacgttcagaccgactcgaagacgagctcgacgggtgcgcggatgaaccggacgccgcggtgaa
gccggtaagaccgggaaccaacggcctgaagggactgcaactggacggacgcttcgtttgcgcggcggacggatctctac
cgaacacaccggacccgcaggagttcggttccgccgaactggatcgcgacacgagacagctcttgttggatttctaccgc
acgcacaccggaatgtgtccgcaggaccggaagcagcatcacgcgctaccgacaatgactcgcgttgtcgcggacgttct
cttaaagcacgagactacattcaaaggaatgttgcagcgtctacagctggaatctcaagcagacgacatgagcttcatca
gctttatagcagagacgatgttcagagacgacaccaccaactggggccggatcgtgagtctggtggccttcggggctgtg
gtgtgctcgcgtctgaaagagctgcagagggagcggtgcgtggagacggtgacccagcagatctcctcctatctgatctc
agaacagcacgactggctgctcaacaacaagcatggattcgtggagtttttccacgtggaggatgtggagtctgtgattc
gtaatgctttgatggctgtggtgggatgcgctgggatcggcgccggtctcgctttcctgatccggtga
>gnl|bcl2dbcds|A0A673HSI2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus rhinocerous GN=MCL-1 (length=693 residues).
atgactctgagtttggggaatagaccgatggctgcgttgggtgtcctcgcggatgagacggacgccgcgctgaagccgct
gaggcccgggacgaacggcctgaaaggactgcagctggacggacggttcgtgtccgcgggagacggctctctaccggcca
ccccggacccgcaggagctcggttccgacacgcagcagcttctgttggacttctatcgcacgcacaccggaatgagtctc
ccggatcggaagcgtcatcacgcgttaccgacaatgaagcgcgtcgtcgcggacgtcctcataaagcaccagatcactta
cacagggatgctgcagcgtctgcagctggactctcagccggacgacttgagcgtcatcgactgtatagcaaagacgatgt
tcagagacgacaccaccaactggggccggatcgtgagtctggtggccttcggggccgtggtgtgctcgcagctgaaggag
ctgcagagggagcggtgcgtggagacggtggcccagcagatctcctcctatctgatctcagaacagcacgactggctgct
caacaacaagggctggcatgggttcgaggagttcttccgcgtggaggacgtggagtctgtggtccgcagcgctctgatgg
ctgttgtgggatgtgctgggatcggcgccggtctcgctctcctgatccgatga
>gnl|bcl2dbcds|A0A673IXK8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus rhinocerous GN=MCL-1 (length=747 residues).
atgttccctgggagtaaagttttaaacgacaaaggcttttggccatgcattggaataacagctcttaacgtcaacagcag
ctcgggcgggcttggtcgcaagccactggtaatgccagaactgaaaccccagaaccagtttacagggaacggactccagg
gctcggtaccatcctcgcctgagccggattgcgaggaagtacaagatgaatacacgtccatctatgacgctctggaaatg
gacacacgagagattattgacattttcttaaaaaactttactggattccctcattctaaaagtgggaataaacaggttct
ggcaacgatgaatcgggttgtggaaagtcttgtggtgaagcacgaactggcttacaaaggtatgattgcacgtctgaatc
tggagcagaaaggagaagatgtgagtttcgtcaagactgttgcaacagaactcttcagcgatggcatcacaaactggggt
cgcattgccagcctgcttactcttggggcaatggtatgcaagcatcagaatgataaaggacttagcaagtgtgcgagtct
ggtggggaaagagatctcttcctatcttctcataacccagcgggactggctgctcaaaaacaatgcatgggatggctttg
tggaattttttcatgtcccaaatacagaagcggctgtgagaaacacattgatggccattggtagtgtggctacattcgga
gctgcacttgcttatttgatacggtga
>gnl|bcl2dbcds|A0A673MXF5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus rhinocerous GN=MCL-1 (length=744 residues).
atgttccctgggagtaaagtttcaaacgacagcggcttttggccatgcattggaatagcagctcttaacgtcaacaacag
ctcgagcgggtttggtcgcaagccacttgtaatgccagaactgaaagcccagaaccagttcacagggaacggtctccagg
gctcggtaccatcctcgcctgagacggactgcgaggaaatagatgattacacctccatctacgccgccctggaaatggac
acgcgagagattattgacgctttcttaaaaagctttacaggactccctcattctaaaagtggaaaaaaccaggttctgtc
tacgatgaagcgggttgtggacagtctcgcggtgaagcacgaactggcttacaaaggtatgattgcacggctgaatctgg
agcagaaaggagaagatgtgagttttgtcaagactgtggcaacagaactcttcagcgatggcatcacaaactgggggcgc
atttgcagcctgctgacttttggggcactggtatgcaagcatcaaaatgatagaggacttagcaagtgtgtgagtctggt
gggggaagagatctcttcctatcttctcacagaccaacgggactggctgctcaaaaacaaagcatgggatggctttgtgg
cattttttcatgtcccggatacagaggcagctatgagaaacacattgatggccattggtggtgtggcaacattcggagct
gctcttgcttatttgatacggtga
© 1998-2020Legal notice