Dataset for CDS BCL-2 of organism Apteryx owenii

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8B9PRT7_BCL2-01      atggctcatccggggagaagaggctacgataaccgggagatagtgctgaa
A0A8B9PRT7_BCL2-02      atggctcatccggggagaagaggctacgataaccgggagatagtgctgaa

A0A8B9PRT7_BCL2-01      gtacatccattataaactctcgcagaggggatacgactgggctgccagcg
A0A8B9PRT7_BCL2-02      gtacatccattataaactctcgcagaggggatacgactgggctgccagcg

A0A8B9PRT7_BCL2-01      gcgaccgggcgccagcgtctccagggctctctcctcctgctgctgctgct
A0A8B9PRT7_BCL2-02      gcgaccgggcgccagcgtctccagggctctctcctcctgctgctgctgct

A0A8B9PRT7_BCL2-01      cttgctgctgctgggacttcctctgatcacactgggctggtgtctccgca
A0A8B9PRT7_BCL2-02      cttgctgctgctgggacttcctctgatcacactgggctggtgtctccgca

A0A8B9PRT7_BCL2-01      ccccgagccccccggctcggctgctgctagtaacgcggccccgggtgacg
A0A8B9PRT7_BCL2-02      ccccgagccccccggctcggctgctgctagtaacgcggccccgggtgacg

A0A8B9PRT7_BCL2-01      ggctgcgcccggcgccaccggtggtccacctcgccctgcgccaagccggg
A0A8B9PRT7_BCL2-02      ggctgcgcccggcgccaccggtggtccacctcgccctgcgccaagccggg

A0A8B9PRT7_BCL2-01      gatgagttctcccgccgctaccagagggacttcgcccaaatgtctggcca
A0A8B9PRT7_BCL2-02      gatgagttctcccgccgctaccagagggacttcgcccaaatgtctggcca

A0A8B9PRT7_BCL2-01      gctgcacctgacacccttcacggccagaggccgctttgtggccgtggtgg
A0A8B9PRT7_BCL2-02      gctgcacctgacacccttcacggccagaggccgctttgtggccgtggtgg

A0A8B9PRT7_BCL2-01      aggagctcttccgagacggggtcaactgggggagaatcgtggccttcttc
A0A8B9PRT7_BCL2-02      aggagctcttccgagacggggtcaactgggggagaatcgtggccttcttc

A0A8B9PRT7_BCL2-01      gagttcggcagcgtcatgtgcgtggagagcgtcaaccgggagatgtcccc
A0A8B9PRT7_BCL2-02      gagttcggcagcgtcatgtgcgtggagagcgtcaaccgggagatgtcccc

A0A8B9PRT7_BCL2-01      cctggtggacagcattgccacctggatgaccgagtacctgaaccggcacc
A0A8B9PRT7_BCL2-02      cctggtggacagcattgccacctggatgaccgagtacctgaaccggcacc

A0A8B9PRT7_BCL2-01      tgcatacttggatccaggacaacggcggctgg--gatgccttcgtggagt
A0A8B9PRT7_BCL2-02      tgcatacttggatccaggacaacggcggctggcaggtaactccaagcagg
                        ********************************  * *  ** *  * ** 

A0A8B9PRT7_BCL2-01      tgtacggcaacagtatgcggcctttgttcgatttctcctggatctctctg
A0A8B9PRT7_BCL2-02      cat-caccggagggacgtg------------------ctggatctc-aga
                          * *  *    * * * *                  *********    

A0A8B9PRT7_BCL2-01      aagactatcctaagtctggttctggtg--ggagcttgcatcactcttggc
A0A8B9PRT7_BCL2-02      cagactttgcgcagcccagc----gtggcggagcttgcctcac-cgagac
                         ***** * *  ** *  *     ***  ********* **** *  * *

A0A8B9PRT7_BCL2-01      gcttatctcggacataagtag
A0A8B9PRT7_BCL2-02      gtt-----------ggagta-
                        * *             **** 

© 1998-2023Legal notice