Dataset for CDS BCL-2-like of organism Poecilia latipinna

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3B3TYN4_BCL2L10      atg--------------caccgag-------------gttct--------
A0A3B3VM25_MCL1-01      atgacggctaattcgacaaccgcgttaaactatctaattttttctcaaaa
A0A3B3TUS7_BCL2L1-      atg-----tcac---gaaacagag---aactagtgcttttct--------
A0A3B3VWI7_BCL2L1-      atg-----tcctacagcaacagag---aactggtggagttct--------
                        ***               ** * *              ** *        

A0A3B3TYN4_BCL2L10      --------------------------------------------------
A0A3B3VM25_MCL1-01      tggagtcggggatggacaaacacactacgaccaggggctcgttgtgcctg
A0A3B3TUS7_BCL2L1-      ---------------------acatta-----------------------
A0A3B3VWI7_BCL2L1-      ---------------------acataa-----------------------

A0A3B3TYN4_BCL2L10      ------------------ccttccgccgtctggatgtg-cagag------
A0A3B3VM25_MCL1-01      aagtcgcaatgggagccactgtagattctcttcattcgcctaaggatccc
A0A3B3TUS7_BCL2L1-      -----------------agtttaaactgtct--------cagaggaacta
A0A3B3VWI7_BCL2L1-      -----------------gctacaaattgtct--------cagagaaacta
                                                    ***        *  **      

A0A3B3TYN4_BCL2L10      ----agccgtcacatatcgctgggag--------gaaaatgtcctgtggg
A0A3B3VM25_MCL1-01      tacaagc--------aacgcccgacgaatctc--gcagtgaccgcatcga
A0A3B3TUS7_BCL2L1-      tccgatccaacacatattgcccaatgagcccccggacagcaccgct---g
A0A3B3VWI7_BCL2L1-      ttcaagctctctgctgaggtccgaggccgacggggccaggaccaattggg
                            * *           *      *        *       *       

A0A3B3TYN4_BCL2L10      ctgtggaaagaga---------ccgtggctgttgcagaggattacatccg
A0A3B3VM25_MCL1-01      atggatatgttgcaaaaagcctccaggagagcagcgacgaaggctctctg
A0A3B3TUS7_BCL2L1-      ctggggacgcgg----------ccggggacgcggggatg-----------
A0A3B3VWI7_BCL2L1-      atgggga--cag----------ccggggccctagcaatg-----------
                         **   *    *          **  *      *    *           

A0A3B3TYN4_BCL2L10      c-------------------------------------ctgtgctgctca
A0A3B3VM25_MCL1-01      ccatgcactccagcgcagcaagacagtgaaaccgtcgcgtctgctgtacg
A0A3B3TUS7_BCL2L1-      --------------------------------------gacgacga----
A0A3B3VWI7_BCL2L1-      --------------------------------------gtccgctg----

A0A3B3TYN4_BCL2L10      agcccacacccagc------------------------------------
A0A3B3VM25_MCL1-01      tgcgagcaaccaagtgctggataacgacacaatggagcttattggcagtt
A0A3B3TUS7_BCL2L1-      -gcagacgttggag-----------------acgcacgctaatgggactt
A0A3B3VWI7_BCL2L1-      -gtcaacagctggg-----------------ccggctccccagggaagt-
                         *    *                                           

A0A3B3TYN4_BCL2L10      -------------ccctccacctcccagc------------gagccggct
A0A3B3VM25_MCL1-01      ttctaagaaattttacaggactttcaaagtg----------tcggtggag
A0A3B3TUS7_BCL2L1-      ttaacgggacaagtccaggatccccgaggcggcaacaggcggcgtcggcg
A0A3B3VWI7_BCL2L1-      -------------cccgggaccctc----------------ccaccggcg
                                       *   *    *                     **  

A0A3B3TYN4_BCL2L10      gc----------------cgccatgaggcgcctggcccaggacgt-----
A0A3B3VM25_MCL1-01      tcaaaataaagctctatctacgatgaaaagggtggtggaggacgttttgt
A0A3B3TUS7_BCL2L1-      gcaacga-------tggacgcggtgaaagtgaccctgcgagacac-----
A0A3B3VWI7_BCL2L1-      tcaaggt-------t-------gtcaaattggttctgaaggacgc-----
                         *                     * *              ***       

A0A3B3TYN4_BCL2L10      ggaggcccagcaccaggctcgctttcactccctggccca-----gggctt
A0A3B3VM25_MCL1-01      cgaagcacagatatgcatacaatggtatgctc---------aacaggctt
A0A3B3TUS7_BCL2L1-      ---ggcccgtgagttcgagctgcgctactccc-gcgccttcaacgacctt
A0A3B3VWI7_BCL2L1-      ---ggcagaggagtttgaacgcctctacacccaaagctttaaacaccttt
                            **             *      *  * *                **

A0A3B3TYN4_BCL2L10      cctgaagcactgcgggacagacct--------ctgctccaacc-tcagaa
A0A3B3VM25_MCL1-01      gct------ctggataaccagccggaca----atatggggtttgttacgg
A0A3B3TUS7_BCL2L1-      cacagcacgctgcacatcacaccggccaccgcctaccagagct-tcgaga
A0A3B3VWI7_BCL2L1-      ccttgca-gctggacatcacccccgacacggcctaccagagct-tcaaga
                                 ***     *   **          *          *     

A0A3B3TYN4_BCL2L10      aggtgatggatgagatggtgggagatggacattttaactgggggagggtg
A0A3B3VM25_MCL1-01      aagtagcacagaatctcttttcagacgggaccaccaactggggtcggatc
A0A3B3TUS7_BCL2L1-      acgtgatggacgaggtgttccgggacgg---cgtcaactggggccgcatc
A0A3B3VWI7_BCL2L1-      ccgtgctggatgagttgttcaagggtga---ggtcaactggggtcgggtg
                          **     *  *  *  *    *  *        ********  *  * 

A0A3B3TYN4_BCL2L10      gtgtccctcttcgccttcgctggcgtgctggccagacagctgcgggaa--
A0A3B3VM25_MCL1-01      gtcagcctggtggcgttcggggctgcagtg----------tgtcagca--
A0A3B3TUS7_BCL2L1-      gtggggctcttcgcgtttggtggcgcgctc----------tgcgtggaat
A0A3B3VWI7_BCL2L1-      gtggccatgtttacctttggggggattctg----------tgtgtggatt
                        **     *  *  * ** *  *      *           **   * *  

A0A3B3TYN4_BCL2L10      -----cagacgggcaagaac------------ccggggccggactctggg
A0A3B3VM25_MCL1-01      ----cctgaaggaaaggggcagagagcattgcgtggagctggtgat----
A0A3B3TUS7_BCL2L1-      gcgttgagaaggagatgagc---------------cacctggtagc----
A0A3B3VWI7_BCL2L1-      gcgttcagaagaatatgagc---------------gagctggtctc----
                               ** *   * *  *                  * **        

A0A3B3TYN4_BCL2L10      aagcagcaggaactgcaacaagagcccgtaagctgccgggcgctggcgga
A0A3B3VM25_MCL1-01      -----------------------------------cc---------agga
A0A3B3TUS7_BCL2L1-      -----------------------------------caggattgtagagtg
A0A3B3VWI7_BCL2L1-      -----------------------------------ccgcattgccgaatg

A0A3B3TYN4_BCL2L10      gaccattgctgattacctggagaagcacaaaaaagactggctgcaggaaa
A0A3B3VM25_MCL1-01      aatatccacgtatctcctggaaaaccagcggga---ctggctagcaaaaa
A0A3B3TUS7_BCL2L1-      gatgaccgtcta---cttggatgagcggattgaaccttgggtggagagcc
A0A3B3VWI7_BCL2L1-      gatgaccactta---cctggacgagcagctcaatccctggatccaaagcc
                         *         *   * ****  * *      *    *** *        

A0A3B3TYN4_BCL2L10      ataatggatgggacgggttt---------tgtagctacgcccacaacgcc
A0A3B3VM25_MCL1-01      acaactcatgggagggctttgtggagttctttagagtatcagatcctgag
A0A3B3TUS7_BCL2L1-      aaggaggatgggaccgtttcgctgagatcttcgg------gggcaacgcg
A0A3B3VWI7_BCL2L1-      agggaggatgggaccgcttcgctaacctgtacgg------ccaggatgcc
                        *      ******  * **          *   *             *  

A0A3B3TYN4_BCL2L10      agagaagtaag---------tcaggactcctccatgaagacggcgctggt
A0A3B3VM25_MCL1-01      tctacagtgag--gaacacgctgatggcgtttgttggggtcgctggtatt
A0A3B3TUS7_BCL2L1-      gcggcagagagcagaagatctcaggagagcttcaaaaactggctgctgct
A0A3B3VWI7_BCL2L1-      gctgcagagggccggaggtttcgggagaccttgaacaaatggctgctagt
                             **   *                   *          *  * *  *

A0A3B3TYN4_BCL2L10      tgctg---------tcgccggagtcggcatcgcagg-------------g
A0A3B3VM25_MCL1-01      gggg----------caacattagcctttctcatcagaaagctacgatcag
A0A3B3TUS7_BCL2L1-      ggggatgagtgtggtgac---ggccttcatagccgg-------------g
A0A3B3VWI7_BCL2L1-      cggtgtggctctgctgaccggagctctgctcgtcat-------------g
                         *               *    *      *                   *

A0A3B3TYN4_BCL2L10      ctcaccttccttct------------------------------------
A0A3B3VM25_MCL1-01      cgcttggtcagcaaaagctaaatacaagccttttggaaatgagagactgc
A0A3B3TUS7_BCL2L1-      tccatcttcgccca------------------------------------
A0A3B3VWI7_BCL2L1-      t---tcgtcgctaa------------------------------------

A0A3B3TYN4_BCL2L10      --------ggtgcg---ctag
A0A3B3VM25_MCL1-01      acaagtctggagccaggataa
A0A3B3TUS7_BCL2L1-      --------gaagcgcctgtga
A0A3B3VWI7_BCL2L1-      --------gaaacg---atga
                                *   *     *  

© 1998-2020Legal notice