Dataset for CDS BOK of Organism Coregonus sp balchen

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A6F9A278_BOK-02      ---------------------------------------------atgga
A0A6F9AR58_BOK-01      atgcgtgtctttcagcaggtgtcagatcagaatcctgcttggcagatgga

A0A6F9A278_BOK-02      ggtgattcgtcgctcctctgtgtttgcagccggggtgatggaggcctttg
A0A6F9AR58_BOK-01      ggtgattcgtcgctcctctgtgtttgcagccggggtgatggaggcctttg

A0A6F9A278_BOK-02      accattccccgtccgacaaagaactggtgtccaagtccaaggcactgtgt
A0A6F9AR58_BOK-01      accattccccgtccgacaaagaactggtgtcccagtccaaggcactgtgt
                       ******************************** *****************

A0A6F9A278_BOK-02      agggactacatacactctaggctcaacctctatgggctaggctcgtccaa
A0A6F9AR58_BOK-01      agggactacatacactctaggctcaacctctatggactgggctcgtccaa
                       *********************************** ** ***********

A0A6F9A278_BOK-02      aactcaggtggactcaacgctttgtgaggtggctgctgtgcttctctgtc
A0A6F9AR58_BOK-01      aactcaggtggactcaacgctttgtgaggtgtctgctgtgcttctctgtc
                       ******************************* ******************

A0A6F9A278_BOK-02      tcggtgatgagctggagtgcatgcggcccagtgtctaccggaacgtggcg
A0A6F9AR58_BOK-01      ttggtgatgagctggagtgcatgcggccgagtgtctaccggaacgtggcg
                       * ************************** *********************

A0A6F9A278_BOK-02      agacagctcaacatctcagtagccatggagaccatggtttccgatgcctt
A0A6F9AR58_BOK-01      agacagctcaacatctcagtggccatggagaccacagtgtctgatgcctt
                       ******************** *************  ** ** ********

A0A6F9A278_BOK-02      tgtcgccgtggcaacagagatattcgcagcaggtatcacatgggggaagg
A0A6F9AR58_BOK-01      tgttgccgtggcaacagagatattttctgcaggcatcacatgggggaagg
                       *** ********************  * ***** ****************

A0A6F9A278_BOK-02      tggtatctatgtatgccgtggccggggctctggcggtggactgcgtgcga
A0A6F9AR58_BOK-01      tggtatctatgtatgctgtggccggggctctggcggtggacagtgtacgt
                       **************** ************************ * ** ** 

A0A6F9A278_BOK-02      cagaaccagccagctacggtccaaaccatagtggacagcctgggtcagtt
A0A6F9AR58_BOK-01      cagaaccagcctgctacggtccaaaccatagtggacagtctgggtcagtt
                       *********** ************************** ***********

A0A6F9A278_BOK-02      tgtccgcaagaacctggccccttggctgaagaaacgcggaggatgggcag
A0A6F9AR58_BOK-01      tgtccgcaagaatttggccccttggctgaagaaacgtggaggatggacgg
                       ************  ********************** ********* * *

A0A6F9A278_BOK-02      acattaagaagtgtgtggtgaagttagatgctgttcctcagccccattgg
A0A6F9AR58_BOK-01      acattaagaaatgtgtggtgaagttagatgccgttcctcagacccattgg
                       ********** ******************** ********* ********

A0A6F9A278_BOK-02      ctgtctcccattgcccaatcctgcaagcactttctgtcaacactgtacat
A0A6F9AR58_BOK-01      ctgtctcccgttgccgaatcctgcaagcactttctgtcaacactagtaat
                       ********* ***** ****************************    **

A0A6F9A278_BOK-02      ctacattatgaaggagccatga
A0A6F9AR58_BOK-01      ctcaggtacccagaag---tag
                       **    **   ** **   *  

© 1998-2023Legal notice