Dataset for CDS BOK of Organism Coregonus sp balchen

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A6F9A278_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Coregonus sp. 'balchen' GN=BOK (length=627 residues).
atggaggtgattcgtcgctcctctgtgtttgcagccggggtgatggaggcctttgaccattccccgtccgacaaagaact
ggtgtccaagtccaaggcactgtgtagggactacatacactctaggctcaacctctatgggctaggctcgtccaaaactc
aggtggactcaacgctttgtgaggtggctgctgtgcttctctgtctcggtgatgagctggagtgcatgcggcccagtgtc
taccggaacgtggcgagacagctcaacatctcagtagccatggagaccatggtttccgatgcctttgtcgccgtggcaac
agagatattcgcagcaggtatcacatgggggaaggtggtatctatgtatgccgtggccggggctctggcggtggactgcg
tgcgacagaaccagccagctacggtccaaaccatagtggacagcctgggtcagtttgtccgcaagaacctggccccttgg
ctgaagaaacgcggaggatgggcagacattaagaagtgtgtggtgaagttagatgctgttcctcagccccattggctgtc
tcccattgcccaatcctgcaagcactttctgtcaacactgtacatctacattatgaaggagccatga
>gnl|bcl2dbcds|A0A6F9AR58_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Coregonus sp. 'balchen' GN=BOK (length=669 residues).
atgcgtgtctttcagcaggtgtcagatcagaatcctgcttggcagatggaggtgattcgtcgctcctctgtgtttgcagc
cggggtgatggaggcctttgaccattccccgtccgacaaagaactggtgtcccagtccaaggcactgtgtagggactaca
tacactctaggctcaacctctatggactgggctcgtccaaaactcaggtggactcaacgctttgtgaggtgtctgctgtg
cttctctgtcttggtgatgagctggagtgcatgcggccgagtgtctaccggaacgtggcgagacagctcaacatctcagt
ggccatggagaccacagtgtctgatgcctttgttgccgtggcaacagagatattttctgcaggcatcacatgggggaagg
tggtatctatgtatgctgtggccggggctctggcggtggacagtgtacgtcagaaccagcctgctacggtccaaaccata
gtggacagtctgggtcagtttgtccgcaagaatttggccccttggctgaagaaacgtggaggatggacggacattaagaa
atgtgtggtgaagttagatgccgttcctcagacccattggctgtctcccgttgccgaatcctgcaagcactttctgtcaa
cactagtaatctcaggtacccagaagtag
© 1998-2023Legal notice