Dataset for CDS BAX-like of organism Apteryx owenii

[Download (right click)] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.8) multiple sequence alignment


A0A8B9NSG1_BAK1-01      atggcctcagggaacgacggtgacccaccaggcgcccgtgtacgctggga
A0A8B9Q115_BOK-01       atgg-------------aagtgctacgccgttcctcagtctttgctgcgg
A0A8B9NSG1_BAK1-02      atggcctcagggaacgacggtgacccaccaggcgcccgtgtacgctggga
                        ****               ***   * **   *  * ** *  **** * 

A0A8B9NSG1_BAK1-01      tggtgatgggcgcaggctatcacaagaggtcaattcagaagaccaggtgg
A0A8B9Q115_BOK-01       aggtgatggaggtt---tttgaccggtctcccactgata--aggagcttg
A0A8B9NSG1_BAK1-02      tggtgatgggcgcaggctatcacaagaggtcaattcagaagaccaggtgg
                         ********  *     * * **  *    * * * * *  *  ** * *

A0A8B9NSG1_BAK1-01      ctgagcagaccgaggaggtgtttcggagctatgc--cttccacc--gcta
A0A8B9Q115_BOK-01       tgtcccaggccaaggctctctgcagggactacataaattccaggctgatt
A0A8B9NSG1_BAK1-02      ctgagcagaccgaggaggtgtttcggagctatgc--cttccacc--gcta
                             *** ** ***   * *   **  ***      *****    * * 

A0A8B9NSG1_BAK1-01      ccaacaggagagagaagagagaggggaggaagtgcccatggacccagaga
A0A8B9Q115_BOK-01       cgagcgggtgtc---agctgga-gcaaacctgagtacaacacaccagtgc
A0A8B9NSG1_BAK1-02      ccaacaggagagagaagagagaggggaggaagtgcccatggacccagaga
                        * * * ** *     **   ** *  *    * *  **     **** * 

A0A8B9NSG1_BAK1-01      ttgcggagattcagcaggagccaagcagcacggggagcctggtgggaaga
A0A8B9Q115_BOK-01       ctggtggtaagctggctgaggtgtccaccatactgctgcgtctaggggat
A0A8B9NSG1_BAK1-02      ttgcggagattcagcaggagccaagcagcacggggagcctggtgggaaga
                         **  *  *  * *   ***     ** **    *   *   * **    

A0A8B9NSG1_BAK1-01      cgcctggccatcatcggcgacgacattaatgagcggtacgacgcggagtt
A0A8B9Q115_BOK-01       gagctggagtacatccgccccaatgt------------ctac-cggaata
A0A8B9NSG1_BAK1-02      cgcctggccatcatcggcgacgacattaatgagcggtacgacgcggagtt
                           ****    **** **  * *  *            * ** **** * 

A0A8B9NSG1_BAK1-01      tc-gctgcatgctgaaatccttgcagcccaccaaggaaaacgcctacgag
A0A8B9Q115_BOK-01       tcgcccgccagctgaacatctcgctgcactcggagacggtggtgacggac
A0A8B9NSG1_BAK1-02      tc-gctgcatgctgaaatccttgcagcccaccaaggaaaacgcctacgag
                        **  * **  ******   ** ** ** * *  **      *     ** 

A0A8B9NSG1_BAK1-01      tacttcaccaggatagcctccagcttgttcgagagtggcattaactgggg
A0A8B9Q115_BOK-01       gcctttctggcagtagctgcacagattttcactgcaggcataacgtgggg
A0A8B9NSG1_BAK1-02      tacttcaccaggatagcctccagcttgttcgagagtggcattaactgggg
                          ***        ****  *     * ***      ***** *  *****

A0A8B9NSG1_BAK1-01      ccgggtgattgcactgctgggctttggctacc-gcatggccatccacgtc
A0A8B9Q115_BOK-01       caaggtggtgtccct-ctatgctgtggcagctgggctggcygtggactgc
A0A8B9NSG1_BAK1-02      ccgggtgattgcactgctgggctttggctacc-gcatggccatccacgtc
                        *  **** *  * ** **  *** ****  *  *  ****  *  **  *

A0A8B9NSG1_BAK1-01      tatcagcatggcataacaggtttcctccgccggatcgcccgctacgttgc
A0A8B9Q115_BOK-01       gtgcgacatgcacagccagctatggttcacaccattgtggactgcctggg
A0A8B9NSG1_BAK1-02      tatcagcatggcataacaggtttcctccgccggatcgcccgctacgttgc
                           *  ****      *** * *  * * *   ** *    ** * * * 

A0A8B9NSG1_BAK1-01      ggagttcatgctccggaaccgcattgcccagtggatcgcccagcagggag
A0A8B9Q115_BOK-01       agagtttgtccgcaag---accttggtgacgtggctgaaaaggagaggag
A0A8B9NSG1_BAK1-02      ggagttcatgctccggaaccgcattgcccagtggatcgcccagcagggag
                         *****  * * *  *     * * *    **** *      *   ****

A0A8B9NSG1_BAK1-01      gatgggtgg-ctgcactcgat-----ctggacaatgtttac---atgaag
A0A8B9Q115_BOK-01       gctgggcagacatcacaaaatgcgttgtgaataccgaccccagccttcgc
A0A8B9NSG1_BAK1-02      gatgggtgg-ctgcactcgat-----ctggacaatgtttac---atgaag
                        * ****  * *  ***   **      ** * *  *    *    *    

A0A8B9NSG1_BAK1-01      tatatgctggcggtggtggccctggtcatggtggggcatttagtggtacg
A0A8B9Q115_BOK-01       tctcactggctcgtggctgccgtttgcagctttgggcacttcctgaaggc
A0A8B9NSG1_BAK1-02      tatatgctggcggtggtggccctggtcatggtggggcatttagtggtacg
                        * *     *   ****  *** *   **   * ***** **  **     

A0A8B9NSG1_BAK1-01      acgcttctt------------caggccctga
A0A8B9Q115_BOK-01       tatcttctttgtccttctgcccgagagatga
A0A8B9NSG1_BAK1-02      acgcttctt------------caggccctga
                           ******            *  *   ***

© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice