Dataset for CDS BAX-like of Organism Apteryx owenii

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B9NSG1_BAK1-01      atggcctcagggaacgacggtgacccaccaggcgcccgtgtacgctggga
A0A8B9NSG1_BAK1-02      atggcctcagggaacgacggtgacccaccaggcgcccgtgtacgctggga
A0A8B9Q115_BOK-01       atgg-------------aagtgctacgccgttcctcagtctttgctgcgg
                        ****               ***   * **   *  * ** *  **** * 

A0A8B9NSG1_BAK1-01      tggtgatgggcgcaggctatcacaagaggtcaattcagaagaccaggtgg
A0A8B9NSG1_BAK1-02      tggtgatgggcgcaggctatcacaagaggtcaattcagaagaccaggtgg
A0A8B9Q115_BOK-01       aggtgatgg----aggtttt--tgaccggtc--tcccactgataaggagc
                         ********    *** * *    *  ****  * *    **  *** * 

A0A8B9NSG1_BAK1-01      ctgag---cagaccgaggaggtgtttcggagct--atgccttcca--ccg
A0A8B9NSG1_BAK1-02      ctgag---cagaccgaggaggtgtttcggagct--atgccttcca--ccg
A0A8B9Q115_BOK-01       ttgtgtcccaggccaaggctctctgcagggactacataaattccaggctg
                         ** *   *** ** ***   * *   **  **  **   *****  * *

A0A8B9NSG1_BAK1-01      ctaccaacaggagagagaagagagaggggaggaagtgcccatggacccag
A0A8B9NSG1_BAK1-02      ctaccaacaggagagagaagagagaggggaggaagtgcccatggacccag
A0A8B9Q115_BOK-01       attcgagcgggtg-------------------------------------
                         * * * * ** *                                     

A0A8B9NSG1_BAK1-01      agattgcggagattcagcaggagccaa-------gcagcacg-gggagcc
A0A8B9NSG1_BAK1-02      agattgcggagattcagcaggagccaa-------gcagcacg-gggagcc
A0A8B9Q115_BOK-01       -------------tcagctggagcaaacctgagtacaacacaccagtgcc
                                     ***** ***** **        ** ***    * ***

A0A8B9NSG1_BAK1-01      tggtgggaagacgcctgg-----ccatcat-cggcgacgac--attaatg
A0A8B9NSG1_BAK1-02      tggtgggaagacgcctgg-----ccatcat-cggcgacgac--attaatg
A0A8B9Q115_BOK-01       tggtggtaagctggctgaggtgtccaccatactgctgcgtctaggggatg
                        ****** ***  * ***      *** *** * **  ** *      ***

A0A8B9NSG1_BAK1-01      agcggtacgacg-----------------cggagtttcg-ctgcatgctg
A0A8B9NSG1_BAK1-02      agcggtacgacg-----------------cggagtttcg-ctgcatgctg
A0A8B9Q115_BOK-01       agctggagtacatccgccccaatgtctaccggaatatcgcccgccagctg
                        *** * *  **                  **** * *** * **  ****

A0A8B9NSG1_BAK1-01      aaatccttgcagcccaccaaggaaaacgcctacgagtacttcaccagga-
A0A8B9NSG1_BAK1-02      aaatccttgcagcccaccaaggaaaacgcctacgagtacttcaccagga-
A0A8B9Q115_BOK-01       aacatctcgctgcac-tcggagacggtggtgacggacgcctttctggcag
                        **   ** ** ** *  *   **    *   ***    * *  *  * * 

A0A8B9NSG1_BAK1-01      tagcctc-cagcttgttcgagagtggcattaactggggccgggtgattgc
A0A8B9NSG1_BAK1-02      tagcctc-cagcttgttcgagagtggcattaactggggccgggtgattgc
A0A8B9Q115_BOK-01       tagctgcacagatt-ttcactgcaggcataacgtggggcaaggtggtgtc
                        ****  * *** ** ***      ***** *  ******  **** *  *

A0A8B9NSG1_BAK1-01      actgctgggctttggctaccgca-tggccatccacgtctatcagcatggc
A0A8B9NSG1_BAK1-02      actgctgggctttggctaccgca-tggccatccacgtctatcagcatggc
A0A8B9Q115_BOK-01       cct-ctatgctgtggcagctgggctggcygtggactgcgtgcgacatgca
                         ** **  *** ****  * *   ****  *  **  *   *  ****  

A0A8B9NSG1_BAK1-01      ataacaggtttcctccgccggatcgcccgctacgttgcggagttcatgct
A0A8B9NSG1_BAK1-02      ataacaggtttcctccgccggatcgcccgctacgttgcggagttcatgct
A0A8B9Q115_BOK-01       cagccagctatggttcacaccattgtggactgcctgggagagtttgtccg
                            *** * *  * * *   ** *    ** * * *  *****  * * 

A0A8B9NSG1_BAK1-01      ccggaaccgcattgcccagtggatcgcccagcagggaggatgggtgg---
A0A8B9NSG1_BAK1-02      ccggaaccgcattgcccagtggatcgcccagcagggaggatgggtgg---
A0A8B9Q115_BOK-01       caagaccttggtgac---gtggctgaaaaggagaggaggctgggcagaca
                        *  ** *    *  *   **** *      *   ***** ****  *   

A0A8B9NSG1_BAK1-01      ---ctgcactcgatctggacaatgtttacatgaagtatatgctggcg---
A0A8B9NSG1_BAK1-02      ---ctgcactcgatctggacaatgtttacatgaagtatatgctggcg---
A0A8B9Q115_BOK-01       tcacaaaatgcgttgtgaataccgacccc----agccttcgctctcactg
                           *   *  ** * ** * *  *    *    **  *  ***  *    

A0A8B9NSG1_BAK1-01      ----gtggtggccctggtcatggtggggcatttagtggtacgacgcttct
A0A8B9NSG1_BAK1-02      ----gtggtggccctggtcatggtggggcatttagtggtacgacgcttct
A0A8B9Q115_BOK-01       gctcgtggctgccgtttgcagctttgggcacttcctgaaggctatcttct
                            ****  *** *   **   * ***** **  **        *****

A0A8B9NSG1_BAK1-01      tca------ggccc------tga
A0A8B9NSG1_BAK1-02      tca------ggccc------tga
A0A8B9Q115_BOK-01       ttgtccttctgcccgagagatga
                        *         ****      ***

© 1998-2023Legal notice