Dataset for CDS BAX-like of Organism Apteryx owenii

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A8B9NSG1_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Apteryx owenii GN=BAK1 (length=654 residues).
atggcctcagggaacgacggtgacccaccaggcgcccgtgtacgctgggatggtgatgggcgcaggctatcacaagaggt
caattcagaagaccaggtggctgagcagaccgaggaggtgtttcggagctatgccttccaccgctaccaacaggagagag
aagagagaggggaggaagtgcccatggacccagagattgcggagattcagcaggagccaagcagcacggggagcctggtg
ggaagacgcctggccatcatcggcgacgacattaatgagcggtacgacgcggagtttcgctgcatgctgaaatccttgca
gcccaccaaggaaaacgcctacgagtacttcaccaggatagcctccagcttgttcgagagtggcattaactggggccggg
tgattgcactgctgggctttggctaccgcatggccatccacgtctatcagcatggcataacaggtttcctccgccggatc
gcccgctacgttgcggagttcatgctccggaaccgcattgcccagtggatcgcccagcagggaggatgggtggctgcact
cgatctggacaatgtttacatgaagtatatgctggcggtggtggccctggtcatggtggggcatttagtggtacgacgct
tcttcaggccctga
>gnl|bcl2dbcds|A0A8B9NSG1_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Apteryx owenii GN=BAK1 (length=654 residues).
atggcctcagggaacgacggtgacccaccaggcgcccgtgtacgctgggatggtgatgggcgcaggctatcacaagaggt
caattcagaagaccaggtggctgagcagaccgaggaggtgtttcggagctatgccttccaccgctaccaacaggagagag
aagagagaggggaggaagtgcccatggacccagagattgcggagattcagcaggagccaagcagcacggggagcctggtg
ggaagacgcctggccatcatcggcgacgacattaatgagcggtacgacgcggagtttcgctgcatgctgaaatccttgca
gcccaccaaggaaaacgcctacgagtacttcaccaggatagcctccagcttgttcgagagtggcattaactggggccggg
tgattgcactgctgggctttggctaccgcatggccatccacgtctatcagcatggcataacaggtttcctccgccggatc
gcccgctacgttgcggagttcatgctccggaaccgcattgcccagtggatcgcccagcagggaggatgggtggctgcact
cgatctggacaatgtttacatgaagtatatgctggcggtggtggccctggtcatggtggggcatttagtggtacgacgct
tcttcaggccctga
>gnl|bcl2dbcds|A0A8B9Q115_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Apteryx owenii GN=BOK (length=642 residues).
atggaagtgctacgccgttcctcagtctttgctgcggaggtgatggaggtttttgaccggtctcccactgataaggagct
tgtgtcccaggccaaggctctctgcagggactacataaattccaggctgattcgagcgggtgtcagctggagcaaacctg
agtacaacacaccagtgcctggtggtaagctggctgaggtgtccaccatactgctgcgtctaggggatgagctggagtac
atccgccccaatgtctaccggaatatcgcccgccagctgaacatctcgctgcactcggagacggtggtgacggacgcctt
tctggcagtagctgcacagattttcactgcaggcataacgtggggcaaggtggtgtccctctatgctgtggcagctgggc
tggcygtggactgcgtgcgacatgcacagccagctatggttcacaccattgtggactgcctgggagagtttgtccgcaag
accttggtgacgtggctgaaaaggagaggaggctgggcagacatcacaaaatgcgttgtgaataccgaccccagccttcg
ctctcactggctcgtggctgccgtttgcagctttgggcacttcctgaaggctatcttctttgtccttctgcccgagagat
ga
© 1998-2023Legal notice