Dataset for CDS BAX-like of Organism Kryptolebias marmoratus

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q3A2A0_BOK-01      ---------------------------atggacatgctgcgccgctcttc
A0A3Q3AGD2_BOK-01      ---------------------------atggacgtgctccggaggtcctc
A0A3Q3AK18_BAX-01      atggctgacggccgagaaaaggacagaatggaggacgagcaggaacc---
A0A3Q3AK18_BAX-02      atggctgacggccgagaaaaggacagaatggaggacgagcaggaacc---
A0A3Q3BJ60_BAX-01      atggca--------------tcgcagggtggcggcgatcaaggaaactcc
A0A3Q3B600_BAX-01      atggca--------------tctggggg-----------agaagaac---
A0A3Q3B600_BAX-02      ttagca---------ttacacgaggggataaatc-----aaaagagc---
A0A3Q3B600_BAX-03      --aacagatcagatcctggatctgggaatcaagctgttaaaagaagc---
                                                                     *   

A0A3Q3A2A0_BOK-01      cgtgtttgccgc---------cgaggtgtttgaccgctcgcccaccgaca
A0A3Q3AGD2_BOK-01      tgcgtttgcctcggaggtcctggaggtgttcgaccgctcgctgacggaga
A0A3Q3AK18_BAX-01      ------------------gcgggg--------------cgccgagggtgg
A0A3Q3AK18_BAX-02      ------------------gcgggg--------------cgccgagggtgg
A0A3Q3BJ60_BAX-01      aaagatcagatcgtagaagtagga--------------actttattgtta
A0A3Q3B600_BAX-01      --------------------------------------------------
A0A3Q3B600_BAX-02      -atatttttattgtgtttctgtgt--------------ctttctgtgt--
A0A3Q3B600_BAX-03      -atatttttattgtgtttctgtgt--------------ctttctgtgt--
                                                                         

A0A3Q3A2A0_BOK-01      agctgctggtggccca----------------------------------
A0A3Q3AGD2_BOK-01      aggagctggtgtccca----------------------------------
A0A3Q3AK18_BAX-01      agaagttgtcgctgatgatcccatattggagcagggagtggtggtcttca
A0A3Q3AK18_BAX-02      agaaggtac-----------------------------------------
A0A3Q3BJ60_BAX-01      aaggatttc-----------------------------------------
A0A3Q3B600_BAX-01      --------------------------------------------------
A0A3Q3B600_BAX-02      ---agtttt-----------------------------------------
A0A3Q3B600_BAX-03      ---agtttt-----------------------------------------
                                                                         

A0A3Q3A2A0_BOK-01      ----ggccaaggctctgtgcagggactacatccactccaag---------
A0A3Q3AGD2_BOK-01      ----gtccaaagctctgtgccgggactacatcctgtccagg---------
A0A3Q3AK18_BAX-01      gagggtacgtaattgagcgtataaac-acagaggaccccgg---ccggca
A0A3Q3AK18_BAX-02      ----gtacgtaattgagcgtataaac-acagaggaccccgg---ccggca
A0A3Q3BJ60_BAX-01      ----atctatgagcgggtgcggcgac-acggaggtggcggtgatgctgta
A0A3Q3B600_BAX-01      ------ctgaaggt--------cgac-atgtagaatcc------attaca
A0A3Q3B600_BAX-02      ----atcttcagatatattcagcgac-atgtagaatcc------attaca
A0A3Q3B600_BAX-03      ----atcttcagatatattcagcgac-atgtagaatcc------attaca
                                               ** *         *            

A0A3Q3A2A0_BOK-01      -ctgcgccgagccgggatcggatggagcaaacccga---gcactcggtgc
A0A3Q3AGD2_BOK-01      -ctcaaccagaacgggctgggatggtccaaaaccgaagtgaacttctccc
A0A3Q3AK18_BAX-01      cgtctcctctgaggatctgggaggaaggtcagatgaacaggag-------
A0A3Q3AK18_BAX-02      cgtctcctctgaggatctgggaggaaggtcagatgaacaggag-------
A0A3Q3BJ60_BAX-01      -gtgacgagggaacagctgg------gggcagcagagctgtgt-------
A0A3Q3B600_BAX-01      -ttgtccagagaggacctgg------gttcagaagagctgacg-------
A0A3Q3B600_BAX-02      -ttgtccagagaggacctgg------gttcagaagagctgacg-------
A0A3Q3B600_BAX-03      -ttgtccagagaggacctgg------gttcagaagagctgacg-------
                         *              * *          *   **   *          

A0A3Q3A2A0_BOK-01      cg------aagggggacctggcggcggtgtcctcggccctcacgtggctc
A0A3Q3AGD2_BOK-01      cgtccaccaacgcagcgctcgctgaggtgtctctggtgctcatttgtctc
A0A3Q3AK18_BAX-01      --------gatcagcagatcaaggatgtggttgatcagctgcttaaaata
A0A3Q3AK18_BAX-02      --------gatcagcagatcaaggatgtggttgatcagctgcttaaaata
A0A3Q3BJ60_BAX-01      --------gacccgaaccacaagaagctcgctcagtgcctacagcagatt
A0A3Q3B600_BAX-01      --------gaatcaaaccacaaggaggtcgctcagaccatgcagctgatc
A0A3Q3B600_BAX-02      --------gaatcaaaccacaaggaggtcgctcagaccatgcagctgatc
A0A3Q3B600_BAX-03      --------gaatcaaaccacaaggaggtcgctcagaccatgcagctgatc
                                *                 *           *        * 

A0A3Q3A2A0_BOK-01      tgtgatgagttggaggaccttcaacccaacttgtaccgtaatgtatctcg
A0A3Q3AGD2_BOK-01      ggcgacgagctggaggccatgcagcccggtctgtacaggaacgtggcgcg
A0A3Q3AK18_BAX-01      gctgatgaactga---------------------acaggaatgtggagtt
A0A3Q3AK18_BAX-02      gctgatgaactga---------------------acaggaatgtggagtt
A0A3Q3BJ60_BAX-01      ggagatgagctgg---------------------acggaaatgtagagct
A0A3Q3B600_BAX-01      gcagatgatctgg---------------------atcgaaatgtacagct
A0A3Q3B600_BAX-02      gcagatgatctgg---------------------atcgaaatgtacagct
A0A3Q3B600_BAX-03      gcagatgatctgg---------------------atcgaaatgtacagct
                          ** **  **                      *  * ** **      

A0A3Q3A2A0_BOK-01      acagctgaacatcaacgcaggatcagagaacatggtgtccgacgccttcc
A0A3Q3AGD2_BOK-01      gcagctcaacatctctgttgccatggagaacatggtctcagatgccttcc
A0A3Q3AK18_BAX-01      ccagagactaatcaatcaggttcaagttaactgtgtaaaagaagtcttca
A0A3Q3AK18_BAX-02      ccagagactaatcaatcaggttcaagttaactgtgtaaaagaagtcttca
A0A3Q3BJ60_BAX-01      acaaaggatgataaatgactcgtcacttagtccctcgaaggacatcttta
A0A3Q3B600_BAX-01      acaaacaatgataaatgatccttcaatccgaccttcatttgaagtgttta
A0A3Q3B600_BAX-02      acaaacaatgataaatgatccttcaatccgaccttcatttgaagtgttta
A0A3Q3B600_BAX-03      acaaacaatgataaatgatccttcaatccgaccttcatttgaagtgttta
                        **       **                            **    **  

A0A3Q3A2A0_BOK-01      tggctgtcgccgctgacattttctccacaggtg---tgacgtgggggaag
A0A3Q3AGD2_BOK-01      tcggcgtggcaacagagatcttctcggcaggta---taacatggggtaag
A0A3Q3AK18_BAX-01      tgatggtgaccaggagcatcttcgttgatggca---tcaactggggtcgg
A0A3Q3AK18_BAX-02      tgatggtgaccaggagcatcttcgttgatggca---tcaactggggtcgg
A0A3Q3BJ60_BAX-01      tgagagttgccattgagatcttttcagacggaaaattcaactggggcagg
A0A3Q3B600_BAX-01      tgaacatcgcctccgtgattttttctgatggaaagttcaactggttcaga
A0A3Q3B600_BAX-02      tgaacatcgcctccgtgattttttctgatggaaagttcaactggttcaga
A0A3Q3B600_BAX-03      tgaacatcgcctccgtgattttttctgatggaaagttcaactggttcaga
                       *     *  *       ** **       **     * *  ***      

A0A3Q3A2A0_BOK-01      gtggtttc-cttgtacaccgtggcaggggccttggcggtggactgtgtgc
A0A3Q3AGD2_BOK-01      gtggtctc-catgtacgccgtggcaggagctctggcggtggactgcgtca
A0A3Q3AK18_BAX-01      gtggtggctctcttccatcttgcctacagactcatttacagggctctgac
A0A3Q3AK18_BAX-02      gtggtggctctcttccatcttgcctacagactcatttacagggctctgac
A0A3Q3BJ60_BAX-01      gtggttgcactcttttactttgcctgtcgactcgtcatcaaagctcttat
A0A3Q3B600_BAX-01      gtggttacgttcttttactttgtctctaaacttgtcatcagagcttataa
A0A3Q3B600_BAX-02      gtggttacgttcttttactttgtctctaaacttgtcatcagagcttataa
A0A3Q3B600_BAX-03      gtggttacgttcttttactttgtctctaaacttgtcatcagagcttataa
                       *****  *     *      ** *                          

A0A3Q3A2A0_BOK-01      gctgcggtcatccagaaattatccacgtcatcacggactgcatggcaaca
A0A3Q3AGD2_BOK-01      gatacggccacccaacgacggctcacgtcctcgtggacagcctgggacag
A0A3Q3AK18_BAX-01      cac-caaccatctggagaacatcagagtcgtcatcagctgggttcttcag
A0A3Q3AK18_BAX-02      cac-caaccatctggagaacatcagagtcgtcatcagctgggttcttcag
A0A3Q3BJ60_BAX-01      tac-caaaattcctgaaatcatcagaactataatcaactggaccatggac
A0A3Q3B600_BAX-01      acc-ccaaattctggaactcgtcagaaaaataatcaactgggccatcgac
A0A3Q3B600_BAX-02      acc-ccaaattctggaactcgtcagaaaaataatcaactgggccatcgac
A0A3Q3B600_BAX-03      acc-ccaaattctggaactcgtcagaaaaataatcaactgggccatcgac
                           *      *                  *      * *          

A0A3Q3A2A0_BOK-01      tttgtcagcaagagtctgaccgcctggttaaaaaagagaggaggctgggg
A0A3Q3AGD2_BOK-01      ttcgtgcgcaaatttctcgttccctggctgaagaggcggggaggatggac
A0A3Q3AK18_BAX-01      gtcatcagggagcagctttacccctggctggtagagcagggaggctgggt
A0A3Q3AK18_BAX-02      gtcatcagggagcagctttacccctggctggtagagcagggaggctgggt
A0A3Q3BJ60_BAX-01      tacctccgggaaaatgtgatcaactggataagagatcaaggtggctggga
A0A3Q3B600_BAX-01      tacctccaggacaatctgatcaactggataagagagcaaggtggctggga
A0A3Q3B600_BAX-02      tacctccaggacaatctgatcaactggataagagagcaaggtggctggga
A0A3Q3B600_BAX-03      tacctccaggacaatctgatcaactggataagagagcaaggtggctggga
                           *     *     *      **** *          ** ** ***  

A0A3Q3A2A0_BOK-01      gga--tctggtgaaatgcgtgttgaatactgatcacagcttccactccca
A0A3Q3AGD2_BOK-01      gga--gatcacgaagtgcgtcgtgaagatggacctctccccgcagcgcca
A0A3Q3AK18_BAX-01      gggggttatccgaaatttttcccgttggaggaacgtagccatcgcag-cg
A0A3Q3AK18_BAX-02      gggggttatccgaaatttttcccgttggaggaacgtagccatcgcag-cg
A0A3Q3BJ60_BAX-01      ggg----------tattcgttcccattttggcactccgacatggcagacg
A0A3Q3B600_BAX-01      ggg----------aatttattcctactttagcaccctgacattgcagacc
A0A3Q3B600_BAX-02      ggg----------aatttattcctactttagcaccctgacattgcagacc
A0A3Q3B600_BAX-03      ggg----------aatttattcctactttagcaccctgacattgcagacc
                       **             *   *          *  *              * 

A0A3Q3A2A0_BOK-01      ctggctggtgtctactgtctgtgccttcggactctacctgaaggctgtgg
A0A3Q3AGD2_BOK-01      ctggttgtcctccgtcgtcgagtccctcaagtatttcctcaccacggtgt
A0A3Q3AK18_BAX-01      tcgttagtgttg--gtggc--aacttt-----------tgtttacta---
A0A3Q3AK18_BAX-02      tcgttagtgttg--gtggc--aacttt-----------tgtttacta---
A0A3Q3BJ60_BAX-01      gtgggagttttc--ctggccggcgttc-----------ttaccactgttc
A0A3Q3B600_BAX-01      tggttcgttttc--ctggctgggattt-----------tcaccgctattg
A0A3Q3B600_BAX-02      tggttcgttttc--ctggctgggattt-----------tcaccgctattg
A0A3Q3B600_BAX-03      tggttcgttttc--ctggctgggattt-----------tcaccgctattg
                         *   *   *     * *                   *     *     

A0A3Q3A2A0_BOK-01      tgttgtacct---------cctcagggagaa------gtga
A0A3Q3AGD2_BOK-01      acgtctacgt---------catgaaggagca------gtga
A0A3Q3AK18_BAX-01      -------------------caggaagacgca------ctga
A0A3Q3AK18_BAX-02      -------------------caggaagacgca------ctga
A0A3Q3BJ60_BAX-01      tagt---------------catgcgcaagat------gtga
A0A3Q3B600_BAX-01      ggatgggagcaaaaaaaaaccagaagaggatgacagggtga
A0A3Q3B600_BAX-02      tggt---------------catgcggaagat------ctga
A0A3Q3B600_BAX-03      tggt---------------catgcggaagat------ctga
                                          *        *         ***

© 1998-2023Legal notice