Dataset for CDS BCL2L2 of organism Nannospalax galili

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C6RJE0_BCL2L2-      atggcgaccccagcctctgccccagacacacgggctctggtggctgactt
A0A8C6RJE0_BCL2L2-      atggcgaccccagcctctgccccagacacacgggctctggtggctgactt
                        **************************************************

A0A8C6RJE0_BCL2L2-      tgtaggctataagctgaggcagaagggttatgtctgtggagctggccccg
A0A8C6RJE0_BCL2L2-      tgtaggctataagctgaggcagaagggttatgtctgtggagctggccccg
                        **************************************************

A0A8C6RJE0_BCL2L2-      gggaaggcccagcagccgaccctctgcaccaagccatgcgggcagctgga
A0A8C6RJE0_BCL2L2-      gggaaggcccagcagccgaccctctgcaccaagccatgcgggcagctgga
                        **************************************************

A0A8C6RJE0_BCL2L2-      gatgagtttgagacccgcttccggcgcaccttctctgatctagccgctca
A0A8C6RJE0_BCL2L2-      gatgagtttgagacccgcttccggcgcaccttctctgatctagccgctca
                        **************************************************

A0A8C6RJE0_BCL2L2-      gctgcatgtgaccccaggctcagcccagcaacgcttcacccaggtgtccg
A0A8C6RJE0_BCL2L2-      gctgcatgtgaccccaggctcagcccagcaacgcttcacccaggtgtccg
                        **************************************************

A0A8C6RJE0_BCL2L2-      acgaacttttccaagggggccccaactggggtcgtcttgtggcattcttt
A0A8C6RJE0_BCL2L2-      acgaacttttccaagggggccccaactggggtcgtcttgtggcattcttt
                        **************************************************

A0A8C6RJE0_BCL2L2-      gtctttggggctgccttgtgtgctgagagtgtcaacaaagagatggagcc
A0A8C6RJE0_BCL2L2-      gtctttggggctgccttgtgtgctgagagtgtcaacaaagagatggagcc
                        **************************************************

A0A8C6RJE0_BCL2L2-      actggtgggacaagtgcaggattggatggtgacctacctggagacgcgcc
A0A8C6RJE0_BCL2L2-      actggtgggacaagtgcaggattggatggtgacctacctggagacgcgcc
                        **************************************************

A0A8C6RJE0_BCL2L2-      tggctgactggatccacagcagtgggggctgggagctagaagcgatcaaa
A0A8C6RJE0_BCL2L2-      tggctgactggatccacagcagtgggggctgggcg------gagttcaca
                        ********************************* *      * * *** *

A0A8C6RJE0_BCL2L2-      gctcgagtcagggagatggaggaagaggccgagaagctaaaggagctaca
A0A8C6RJE0_BCL2L2-      gctctatacgggga---------------cggggccctggaggaggcgcg
                        **** *  * ****               ** *   **  *****   * 

A0A8C6RJE0_BCL2L2-      gaacgaggtggagaagcagatgaatatgagtccacccccaggcaatgctg
A0A8C6RJE0_BCL2L2-      gcgtctgcgggagggg-aactgggcatcagt------gaggacagtgctg
                        *     *  ****  * *  **   ** ***         * ** *****

A0A8C6RJE0_BCL2L2-      gcccagtgattatgtctattgaggagaagatggaggctgatgcccgctct
A0A8C6RJE0_BCL2L2-      ac-----------------------------gggggctg-----------
                         *                             ** *****           

A0A8C6RJE0_BCL2L2-      atctatgttggcaatgtggactatggtgcaacagcagaagagctggaagc
A0A8C6RJE0_BCL2L2-      --------tggcactgggggccctggt-----------------------
                                ***** ** ** *  ****                       

A0A8C6RJE0_BCL2L2-      tcactttcatggctgtggttcggtcaaccgtgttactatactctgtgaca
A0A8C6RJE0_BCL2L2-      -------------------------------------------------a
                                                                         *

A0A8C6RJE0_BCL2L2-      aatttagtggccatcccaaagggtttgcatatatagagttctcagacaaa
A0A8C6RJE0_BCL2L2-      actgtaggggcctt------------------------------------
                        * * *** **** *                                    

A0A8C6RJE0_BCL2L2-      gagtcagtgaggacttccctggccttagatgagtctctgtttagaggaag
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
                                                                          

A0A8C6RJE0_BCL2L2-      acaaatcaaggtgatccccaaacgaaccaacagaccaggtatcagcacaa
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
                                                                          

A0A8C6RJE0_BCL2L2-      cagaccggggcttcccacgtgctcgttaccgtgccaggactaccaactac
A0A8C6RJE0_BCL2L2-      --------------------------------------------------
                                                                          

A0A8C6RJE0_BCL2L2-      aacagttcccgttctcgattctacagtggttttaacagcaggccccgggg
A0A8C6RJE0_BCL2L2-      -----------------------------ttttgccagcaag--------
                                                     ****  ***** *        

A0A8C6RJE0_BCL2L2-      tcgagtctacaggggccgggctagagcgacatcatggtattccccttact
A0A8C6RJE0_BCL2L2-      -------------------------------------------------t
                                                                         *

A0A8C6RJE0_BCL2L2-      aa
A0A8C6RJE0_BCL2L2-      ga
                         *

© 1998-2022Legal notice