Dataset for CDS BCL2L2 of organism Pan paniscus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2R9A2Q3_BCL2L2-      atggcgaccccagcctcagccccagacacacgggctctggtggcagactt
A0A2R9A2Q3_BCL2L2-      atggcgaccccagcctcagccccagacacacgggctctggtggcagactt
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------

A0A2R9A2Q3_BCL2L2-      tgtaggttataagctgaggcagaagggttatgtctgtggagctggccccg
A0A2R9A2Q3_BCL2L2-      tgtaggttataagctgaggcagaagggttatgtctgtggagctggccccg
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------

A0A2R9A2Q3_BCL2L2-      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
A0A2R9A2Q3_BCL2L2-      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------

A0A2R9A2Q3_BCL2L2-      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca
A0A2R9A2Q3_BCL2L2-      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------

A0A2R9A2Q3_BCL2L2-      gctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccg
A0A2R9A2Q3_BCL2L2-      gctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccg
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------

A0A2R9A2Q3_BCL2L2-      atgaactttttcaagggggccccaactggggccgccttgtagccttcttt
A0A2R9A2Q3_BCL2L2-      atgaactttttcaagggggccccaactggggccgccttgtagccttcttt
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------

A0A2R9A2Q3_BCL2L2-      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaacc
A0A2R9A2Q3_BCL2L2-      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaacc
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------

A0A2R9A2Q3_BCL2L2-      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
A0A2R9A2Q3_BCL2L2-      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------

A0A2R9A2Q3_BCL2L2-      tggctgactggatccacagcagtgggggctgggcg---------------
A0A2R9A2Q3_BCL2L2-      tggctgactggatccacagcagtgggggctgggagctggaagctatcaaa
A0A2R9A2Q3_BCL2L2-      --------------------------------------------------

A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      gctcgagtcagggagatggaggaagaagctgagaagctaaaggagctaca
A0A2R9A2Q3_BCL2L2-      ---------------atggaggaagaagctgagaagctaaaggagctaca

A0A2R9A2Q3_BCL2L2-      ---------------------------gagttcacagct---ctatacgg
A0A2R9A2Q3_BCL2L2-      gaacgaggtagagaagcagatgaatatgagtccaccaccaggcaatgctg
A0A2R9A2Q3_BCL2L2-      gaacgaggtagagaagcagatgaatatgagtccaccaccaggcaatgctg
                                                   **** ***  *    * ** * *

A0A2R9A2Q3_BCL2L2-      ggacgg-------ggccctggaggaggcg-cggcgtctg-----------
A0A2R9A2Q3_BCL2L2-      gcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttcc
A0A2R9A2Q3_BCL2L2-      gcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttcc
                        *  * *       * ** * ******  *  ** * ***           

A0A2R9A2Q3_BCL2L2-      -------------------------------cgggaggggaactgg----
A0A2R9A2Q3_BCL2L2-      atctatgttggcaatgtggactatggtgcaacagcagaagagctggaagc
A0A2R9A2Q3_BCL2L2-      atctatgttggcaatgtggactatggtgcaacagcagaagagctggaagc
                                                       * * **  ** ****    

A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      tcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgaca
A0A2R9A2Q3_BCL2L2-      tcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgaca

A0A2R9A2Q3_BCL2L2-      --------------------------------------------------
A0A2R9A2Q3_BCL2L2-      aatttagtggccatcccaaagggtttgcgtatatagagttctcagacaaa
A0A2R9A2Q3_BCL2L2-      aatttagtggccatcccaaagggtttgcgtatatagagttctcagacaaa

A0A2R9A2Q3_BCL2L2-      gcatcagtgaggac-----------------agtgct------gacgggg
A0A2R9A2Q3_BCL2L2-      gagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
A0A2R9A2Q3_BCL2L2-      gagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
                        *  ***********                 *** *       ** *  *

A0A2R9A2Q3_BCL2L2-      gcc-------gtg----------gcactgggggccctggtaactgta---
A0A2R9A2Q3_BCL2L2-      gcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaa
A0A2R9A2Q3_BCL2L2-      gcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaa
                        **        ***          * **     * ** ** * * * *   

A0A2R9A2Q3_BCL2L2-      ------ggggcctt------------------------------------
A0A2R9A2Q3_BCL2L2-      cagaccggggttttccacgagcccgctaccgcgcccggaccaccaactac
A0A2R9A2Q3_BCL2L2-      cagaccggggttttccacgagcccgctaccgcgcccggaccaccaactac
                              ****  **                                    

A0A2R9A2Q3_BCL2L2-      -----------------------------ttttgctagcaag--------
A0A2R9A2Q3_BCL2L2-      aacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
A0A2R9A2Q3_BCL2L2-      aacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
                                                     ****   **** *        

A0A2R9A2Q3_BCL2L2-      -------------------------------------------------t
A0A2R9A2Q3_BCL2L2-      tcgcgtctacaggggccgggctagagcgacatcatggtattccccttact
A0A2R9A2Q3_BCL2L2-      tcgcgtctaca--ggtcaggatag--------------------------

A0A2R9A2Q3_BCL2L2-      ga
A0A2R9A2Q3_BCL2L2-      aa
A0A2R9A2Q3_BCL2L2-      --

© 1998-2022Legal notice