Dataset for CDS MCL-1 of organism Cynoglossus semilaevis

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3P8V8T6_MCL1-01      ctggatat----------------------------ggtgc--------t
A0A3P8VKM5_MCL1-05      atgaatattataaagaacaaccaagctaagttgaacgttgccaccggagt
A0A3P8VKM5_MCL1-04      atgaatattataaagaacaaccaagctaagttgaacgttgccaccggagt
A0A3P8VKM5_MCL1-03      atgaatattataaagaacaaccaagctaagttgaacgttgccaccggagt
                         ** ****                            * ***        *

A0A3P8V8T6_MCL1-01      cataagc-------------------------------------------
A0A3P8VKM5_MCL1-05      cctaggctgtttcatcgtccctcaaaatggagtcgttaatggaaccatgc
A0A3P8VKM5_MCL1-04      cctaggctgtttcatcgtccctcaaaatggagtcgttaatggaaccatgc
A0A3P8VKM5_MCL1-03      cctaggctgtttcatcgtccctcaaaatggagtcgttaatggaaccatgc
                        * ** **                                           

A0A3P8V8T6_MCL1-01      ----------------------------------agtgtct---------
A0A3P8VKM5_MCL1-05      actatggcactggaaactccacgcctatagccttagcgtcttcgctgtca
A0A3P8VKM5_MCL1-04      actatggcactggaaactccacgcctatagccttagcgtcttcgctgtca
A0A3P8VKM5_MCL1-03      actatggcactggaaactccacgcctatagccttagcgtcttcgctgtca
                                                          ** ****         

A0A3P8V8T6_MCL1-01      --------------------------------------------------
A0A3P8VKM5_MCL1-05      acccacaacgactcaatgagttctgtcaccgaaacccaaaggcgacccaa
A0A3P8VKM5_MCL1-04      acccacaacgactcaatgagttctgtcaccgaaacccaaaggcgacccaa
A0A3P8VKM5_MCL1-03      acccacaacgactcaatgagttctgtcaccgaaacccaaaggcgacccaa

A0A3P8V8T6_MCL1-01      ---------gtttgac----------------------------------
A0A3P8VKM5_MCL1-05      ggacctccaggttaacacggcaaacggacatgccagaaagagccactgtg
A0A3P8VKM5_MCL1-04      ggacctccaggttaacacggcaaacggacatgccagaaagagccactgtg
A0A3P8VKM5_MCL1-03      ggacctccaggttaacacggcaaacggacatgccagaaagagccactgtg
                                 * ** **                                  

A0A3P8V8T6_MCL1-01      -------------------gctgtgcac----------------------
A0A3P8VKM5_MCL1-05      aggtggacgaaggctctgagccgtgcacgccggagccacactcggaagca
A0A3P8VKM5_MCL1-04      aggtggacgaaggctctgagccgtgcacgccggagccacactcggaagca
A0A3P8VKM5_MCL1-03      aggtggacgaaggctctgagccgtgcacgccggagccacactcggaagca
                                           ** ******                      

A0A3P8V8T6_MCL1-01      --------------------------------actggaaaatgacaccag
A0A3P8VKM5_MCL1-05      gaactcgatgtctcccaggccggggacgaggtgctggataccgataccaa
A0A3P8VKM5_MCL1-04      gaactcgatgtctcccaggccggggacgaggtgctggataccgataccaa
A0A3P8VKM5_MCL1-03      gaactcgatgtctcccaggccggggacgaggtgctggataccgataccaa
                                                         ***** *  ** **** 

A0A3P8V8T6_MCL1-01      gcaattgatttgcgatttcctgaaagacttcaccacaaaatctacccaac
A0A3P8VKM5_MCL1-05      ggaacttatttttcagttctacagagactttacaactcattctccgtcga
A0A3P8VKM5_MCL1-04      ggaacttatttttcagttctacagagactttacaactcattctccgtcga
A0A3P8VKM5_MCL1-03      ggaacttatttttcagttctacagagactttacaactcattctccgtcga
                        * ** * ****   * ***   * ****** ** **  * *** *     

A0A3P8V8T6_MCL1-01      gattggtggagagcaaagcattgtcaactatgaaaagagtggtaaaaggc
A0A3P8VKM5_MCL1-05      aatggggcgaacgcaaagcgcttacgacgatgaaaagagtcgtggacgac
A0A3P8VKM5_MCL1-04      aatggggcgaacgcaaagcgcttacgacgatgaaaagagtcgtggacgac
A0A3P8VKM5_MCL1-03      aatggggcgaacgcaaagcgcttacgacgatgaaaagagtcgtggacgac
                         ** **  **  *******  *  * ** *********** **  * * *

A0A3P8V8T6_MCL1-01      attttagacaaacacagacatgcattcagtggcatgatcaacaacctctc
A0A3P8VKM5_MCL1-05      gttttggagaaacacagatatgcatacaatggtatgatcaacaaactttc
A0A3P8VKM5_MCL1-04      gttttggagaaacacagatatgcatacaatggtatgatcaacaaactttc
A0A3P8VKM5_MCL1-03      gttttggagaaacacagatatgcatacaatggtatgatcaacaaactttc
                         **** ** ********* ****** ** *** *********** ** **

A0A3P8V8T6_MCL1-01      ttttgaaaacggagtatataatattggagttgttggggcagtggccagga
A0A3P8VKM5_MCL1-05      attagaaaacagacagggtgatttgactttcatcagctctgttgccaaaa
A0A3P8VKM5_MCL1-04      attagaaaacagacagggtgatttgactttcatcagctctgttgccaaaa
A0A3P8VKM5_MCL1-03      attagaaaacagacagggtgatttgactttcatcagctctgttgccaaaa
                         ** ****** **     * ** *     *  *  *  * ** ****  *

A0A3P8V8T6_MCL1-01      gcctcttcagagatggcacctccaactggggtcgaatagttagcctggtt
A0A3P8VKM5_MCL1-05      gcctgtttggagatggtaccacaaactggggtcggatcaccagcctggtg
A0A3P8VKM5_MCL1-04      gcctgtttggagatggtaccacaaactggggtcggatcaccagcctggtg
A0A3P8VKM5_MCL1-03      gcctgtttggagatggtaccacaaactggggtcggatcaccagcctggtg
                        **** **  ******* *** * *********** **    ******** 

A0A3P8V8T6_MCL1-01      gcatttggggcagtgctttgtcagcacctaaaggagaaaggctgggagaa
A0A3P8VKM5_MCL1-05      gcctttggggcagttgtgtgtcagcacctaaaggagtgtggtcaagagaa
A0A3P8VKM5_MCL1-04      gcctttggggcagttgtgtgtcagcacctaaaggagtgtggtcaagagaa
A0A3P8VKM5_MCL1-03      gcctttggggcagttgtgtgtcagcacctaaaggagtgtggtcaagagaa
                        ** ***********  * ******************   **    *****

A0A3P8V8T6_MCL1-01      cacggtggaccaggttggacaggagatcgcctcatacctgttgtcttatc
A0A3P8VKM5_MCL1-05      ctcaacagagctagtaggaagagagatctcctcgtacctgctgtcttacc
A0A3P8VKM5_MCL1-04      ctcaacagagctagtaggaagagagatctcctcgtacctgctgtcttacc
A0A3P8VKM5_MCL1-03      ctcaacagagctagtaggaagagagatctcctcgtacctgctgtcttacc
                        * *    ** *  ** ***   ****** **** ****** ******* *

A0A3P8V8T6_MCL1-01      agaaagactggctcctgaaaaacaactcctgggatggcttcgtggaattc
A0A3P8VKM5_MCL1-05      agagagattggctattgaaaaacaactcttgggatggctttgtagagttc
A0A3P8VKM5_MCL1-04      agagagattggctattgaaaaacaactcttgggatggctttgtagagttc
A0A3P8VKM5_MCL1-03      agagagattggctattgaaaaacaactcttgggatggctttgtagagttc
                        *** *** *****  ************* *********** ** ** ***

A0A3P8V8T6_MCL1-01      ttccaaggacaagagccagagaaggcaattagatgtacacttcttggctt
A0A3P8VKM5_MCL1-05      ttcagagtagaagacccagaggcaaccatgaggaacaccctccttggtct
A0A3P8VKM5_MCL1-04      ttcagagtagaagacccagaggcaaccatgaggaacaccctccttggtct
A0A3P8VKM5_MCL1-03      ttcagagtagaagacccagaggcaaccatgaggaacaccctccttggtct
                        ***  ** * **** ******    * ** **    ** ** *****  *

A0A3P8V8T6_MCL1-01      tgttgggtttgcaggactttgggcaacacttgccttactgatgagatatt
A0A3P8VKM5_MCL1-05      ttttggagttgctggactcggggcaacactggccctgttgatcagatg--
A0A3P8VKM5_MCL1-04      ttttggagttgctggactcggggcaacactggccctgttgatcagata--
A0A3P8VKM5_MCL1-03      ttttggagttgctggactcggggcaacactggccctgttgatcaggtg--
                        * ****  **** *****  ********** *** *  **** ** *   

A0A3P8V8T6_MCL1-01      ttctcaggtttgtgtggtag
A0A3P8VKM5_MCL1-05      -------------gaaatga
A0A3P8VKM5_MCL1-04      -------------a------
A0A3P8VKM5_MCL1-03      -------------a------

© 1998-2020Legal notice